Description :
From Genome Similarity Track
Location :
Scaffold_314:453- 7325
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_314-fgenesh-gene-0.060S ribosomal protein L26-1
Pytiw_DAOMBR242034maker-piw_contig_314-snap-gene-0.7Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_314-fgenesh-gene-0.3Calmodulin binding protein

Sequence
6872 bases(100 bases per row)
CCAGTATCTCTTTCTTGCCTGATAACAAAAGTACGTGATGCCACTGCTCTCTGTATGCCTGCCTCTAGGTCTTGCGAATGGCGTCGCGCGCACGAGCCAT
CCCTCCGCAATCTCACAGGCCTCACTCTGGTCATGAACACGACGTTCTAACGCTGCCGCTGTCTCTATGTGTTGCGCCCCACAGTGAAGTTCAACTCGAC
CGTCTCCTCCTCCCGCCGAAAGAGCCGCAAGGCTCACTTCGGCGCGCACTCGACGCAGCGCCGCGTGCTCATGAGCGCGCCGCTCTCCAAGGACTTGCAG
AACAAGTACAATGTAAGTTAGTGGTTTGCTTCTGCAGACACACTTATACTTTCAGCGTTGTAAGTCCATGTCAGTGGAGCTCTTCCCCTTTATGGAGGGG
AGGGATCCGTCCCCAACTGGCACTTCATGGCATCGTGTGATATGTAAGTGCCGATCTCCAGTCGCTGGCGGCGACNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGACGTGATCGATGAACGCTTTCTCTCTTGCT
TGCCATGGCGAACTGGGGTGTGTTAATGCTCACTGTGTGATCTCTATCTGTCTTTGTGAATTATCAGGTTCGCTCCATCCCGATCCGCAAGGACGATGAG
GTGACCGTTGTCCGTGGCACGTACAAGAACCGTGAGGGCCGCGTGACCGCCGTGTACCGCAAGAAGTTTGTGATCCACGTCGCGGGCGTCGTGAAGGAGA
AGGCCAACGGCCAGGCCGTGCCCATCGGCCTCGACGCGTCCAAGGTCGTGATCTCTAAGCTCAAGCTCGACAAGGACCGCAAGAAGATCTTGGAGCGCAA
GAACCGCGCCACCGGTGACGACGCCAAGGGCAAGTTCACCGAGGCCGACGTCGCCCAGGCCAACGTCGACTAAGTCGAGCAGCATCATCTTTTAAAGCAG
CATCTAAAAGAAAGAGGGAACCTCCCGGTTTGCACCAGCAGCAATTGAGCCACCATTTTCATGTGAATTCTGTGATATCTCATGATTCAAGACCACCAAC
CTCTCATGTGTCCAAGGAGTTCTCTCTTATTAGGCGAGCTTCTGCATCTCATGCTGGATCATGTTCTTGAGCGACACGGCCGGCTGGTCTGACACAAGCT
CCACGAGCAAGTTGATAAAGTCGACCTCGCGCTCCGAGAACTCGCGCAGCGACAGCTCTTGCATCTCGAGGCGGCGCAGCAGCTTGTTGACGAGCGGCAC
GAGCTGCGGCAGCGACCGCTTGACCGTCGCGAACACTTTCTCCTCGCACTCCTTGGCCGCTGCGTCCCGCCGCCACGAAGGATCGGACGAGCTGCTGCTG
TTGTTGTGGTGCATGCCAGCAGAGTCGAGGCCCTTCAGGCGACTCATGCGGTCGCCGTGCTTCTTGACAAACTTGTCGAGGATCTCGGCCTTCCGTTGTT
CCTGCAACCACAATTTCAAGACAACATCAGGGTGCAGACCAATGTGAATAACCAGGAAGTACATCTCAATACAGTAGACTCACATTCTCCAGTGACGCGA
GGTACATCTTGGTCGCGAGCAGCTCTTCGGCCGCGGCGGCTTTCTCGACCAGGAGCTTTTCGTTCTCCTGGTGCAGCAAGTCTGCCTCTTCCTGCGCTTG
GTTCATCTCGGCGTTCATACGCAGCTTGCCCAGTTTTGTCGCCAGTAGCGCTTCATCTTTGCTGCTCAGCTCCCTGTCATAGGAAGACGCGACACACGTT
AAACAAGGTTAACCAACAATTTCCATAACAACGTGGTTCTCGATATCGCTCCCCACCGTGACAACTGGTCGACACGCCTCGTGGAATCGCCAACCAATTT
GCTATGCACGAGGAATTGCCTACCAGCAAGTGATTAAAATCATTTGTTTTGTAAGCGTTGAGTGAGTCTCCACATGCGAATATGCAGACAGCAAACTCAC
CGTTCTCGCTTTCGAAACTCGAGAAGCTGCTTCTCCATCTGTTGCTTCTCGTCCACCACCGTCTGGTACTTCTTCTTGAGTTCGTGCACCGATCCGGGAC
CGCTGCATCCATCACCTTCCGTCATCTACAAGCATGTATGCGAAAGCATTTGTTAGACAATGGTTCAAGTTACGCACAGGCAGACTCAAACCAACCTTAA
GCTCCAGCGCGACGTTGCGATCCCGCAGCTGCTGCACCTCCTTGAGCAGCAGCTGCAGCTCCTGCTCGTACTGGTCAAATACTTTGGGCAGCGCCGACTG
CTTCTCGAGCGTGCGAACTTTGCTGCGTAGCGCCACGTTCGAGAGCTTAATGTTCTCGATCTGGACTTCAAAGCTCGCGCGCACCTCGTCGAGGTCGTGG
ATAGCGTCGGCGGCCTGCGCCTCGGCCATTTCACGCAGCTCCTGCTGCTCCTGCACGATTGTGAGCAGCGCATCATAGTTTTTCCGAAGCAGCGCTGCCT
CGGTGGCTTGTATCTTGGCCGCCGTGAGCGCATCCAGGCCGTCAAGGTTTGCAGGTGCCATCGATTGCGACGGCACGTTCGCTCGCTCCAGTACCTCGTG
TAGTTGTTGTCCACGCGGTTGAGAAGACATTGGAGATGGTAACGCAGTTGAGGAACGTTGCTGCGGTGGACTTGTTGCTGGTGGTCGTGAAAACGACACC
GACTTCGACGCTGATGCTTGCCTTCCGAAATCGAGCGGTTGGACACCAGTCGAGCCTGGTGTGGCCCAATAGTGTGCGGAACTGGAAGCGATGAAATCGG
AAGATGGAGAGCTCAATGATGTCGTATTTGTTGGCGCTCGAAACGATTGTGAGATGTGCAACGGAGGTGCTGGAATTGGGTACGCAGTCGAAAACGAAGA
GTCGGGAGCTGCATGCCGAATCTGCTGAGCTGTCCGCTGCGGAGAGCTCGGTGTTTCGAAGCTGACTGTTGTTTCACCATACGCCTCACTATCGCCATCC
GCGATCGGTAGCGGCTCGGAGCTTGTTCGCCGGAATCTGGTTTTATCCGGTGATGACGCCATGGCAGCACGAAGTCTCTCAAGTAGATCTGCACTTGTCT
GCTGGATCATGTTTCTCGTCGACGATGTTGCTGCTTCTGGTAGTGTTTCAAATCTGAACCCTCTCGCTGGCGAATCGACTGAGGCAATCCCCTGACTGCT
TTCAAACTTGAGTTCTTCGTTCCCCTCATTGGCTTCAAAGCTAATGAACGCGGACTCGACTGACTGATGTTGCTGAGACGGAAATGGGACGATCGTGTCG
ATTTTGCCGCCGAGGATGTCGCGCTTCCGCTGCGAGAAGGATTCGAGCCAGCTCAGGGTCTCGGACTCCATCGGCATGGAGCTGAACGAGTCTTTCCGTT
GGCTGGGCTGTCTAGGATGCTGGTACACGCTCTTGGTCGATGATGATGGTGATGCCAATGGTGATGGTCTGCTCGAAGACAGAATCGACGACAGGTTGGA
CGCTGAAAACGGCGCAGCAGGCGTCGTGAACGATGGTTGCGGGGTCAATTCGAACGACGTGGACGCCGATGGCGAGCTTGAGGCTAATCGACTCAGCAGC
GACTCGCCGACTGCAACGGCTGTCATTGCTTTTGCTGCGACGTCATCATCTCCATAGCTTGAACCGTGCTGCTTGGTCTCGTCAACTGAAGAAACTGGAC
GAAGGAGGGCGTCAGGTGGAGTCTGGAAACCCAGCTGCATGAACTCGACCCCACGAAGCCGCTTGCAGGTGCAGGAGAACCCTTTTACATTCGCGACTGC
ATTCAGGAGCTGCACACCCTCCCGAAGGCTCGTGCGCGAGTCGATCACGTTTGCGTACAGAAATGTCTTTGCGTTCGCAGTCAGCAGTGGGAGGATGAAG
TTTGACAGCACCATCTTCCTGGTCTTGTACTTGGGGGTTGAAGGGCCCGACATACCACCGACTCCTCCTGTTCTGGTCTGCGTCTGGGAAGTAGCAGGCG
ACGCCATTGTGTACCGTGGTGACATTAATGGCTGTCGAATCTCATGTAGGATGTCAAAGAGCTCCTGCTTCTCCTGGATCGACGTCTGGTCCTTGAAATC
CTTGAGATCGATGAGGTCCACGAAGTGCATTGTGCTCACCTGTCCGTTGTAGAAGAACGCGAGCCTGAGAAAGAAATGCGCGTGCTCGGCATTGTATTTC
ATCACGATTCGGTTCGTCTTCGCGGTCTGCAGGATCTTGCACGCGCTCGCAAAAGTCTTCGCTTCGAGAGACACGAACGACAACGGCGGACTCGATGAAG
TGGTGTTAGCCGATCTTTGCTGAGCATGCGACGATGACGGGGGCGACATGACAGGCTTGAGCAGATCGATCACCTGGTTGTTCACGATGATCCAGCTGCT
GATCCCGACCCGCCAGCCCAGACTTGCCATGGAGGTCTGCTGCTGCGAACGCATTGAAGCCGACAGCCGAGGAGACCGGAAGAACTCGTGAAGGAGCCCT
CCGAGCTGTCCGTAGAGCTCCAGAACCTCTTTTTCGTTCTCCAATGCCTGCTGCTGCGTGGCGCTGACATGTTGCGCCGACGCGTGCTGGGTAACAGGAT
TGCTGATACTGCTGCCAGTGCTTTTCCCAAAGAGCAGGCGATACTTCTGCGTCGGATGCACACCCCAGGCGACAATGTTGGTGTTCCAGCCATCGCAGAC
GTTTCGGAACGCTGGCTGCGTGATCTCGCGATAGAAATCGACGGCGTGGGACGTCGACGTTGACGCGAAGAGCGTGTGGAAGTCCCATTCTGCACTAGGC
ACTGAGCTTGCACTGGTGCTGCTGCTGGTATTCGCATTGCCACTGATTCCGCCGTGCTGACCTGCCGTCGATGTGACTGCAGACTGATCTCCAAGCGGCT
TGTTGACCACGCGGACACAGTGACGCTCGGGAGCGACCTCAAACACGGGCGTCGCGCGGTTTGCGGCTGTGATGAAGCACGACACGTGTACCTGGCTCAG
CACCACTGCGGTCGCTGGGTTTGGACTCGACGCACTGGCAGCCTGAGTCGCACTTGCGTTGGCTCTCCCCGACGGATTCATCATTCTCCCAGCGACTGTT
CATGCAGGCGAGTGAGCGAATGAACGCATGTGATAGATAATCCAGAGCAAGCGGCATATCTGAGACGAATGGAGAGACCCACACCGGGATCTTGAAAGCT
TAACTTAGCAATATATATTCATAAAATAAAAACGCCTCACGTAAATCATCAACACTAACTAACCGCTGCTGGCTTCTGCTGGGGTGCACTCGCTTGTCCT
CTCCTGTGCCCACCAAATCCTGTTTGGAGGACGAAGTGTCGGGCTCTTCAGATCCTGAAGCACCGTTCATTTCTACCTCGTTACTAAATACCATTACAGG
AGATCTCGTCTCACTAGAGTACATACTTTTACCGTGTCCTTCTCTCTTCTTTGTCGCTCTCGCTGTCGTCGCTTGGTTATTCTTGCAGCTCGCAGGTCGC
AAGTAGCTCGATGGGGTCGTCGAAAGCTGTACCGCAGGTGCCCGAACGCGACAGGCCGGAGGTGTCAAAGTCCATGTCCTGGAAATCGAAATCAGTCGAT
GCGATCACGCCGTTCGTCCCCTCTTCCTCCTCCATGATGCAATCTTCGGCTGCGTCTGGCTCGTTCATGTCGCAGATACCGTCCCCGCTCATCGACACTC
GCTCAACGAGCTCGTCGAACATGCCGTTCTTCCACAATGAATGCTTGTGCCACAGAAAGTTGAGTACCCGGTATGCCTTCCAAAAATGTGCGTTGTCGAG
CTTCCGAATCAGCGCGCCGTTCACTGTCGCCCGGTACACTTTCTGGATTCGCTGAACGTCAACCTCCACGTCGCGCAAATCGACGCCATTCTCGACCAGG
AACTGAAGCAACACGAGCAGCTCGTGCTCCGACGGACGGTAATGACCGGAGTGGGGATAAATAGTCTTAATAATGCCATCGGTGATCACCATCATGCCCG
CCGTCTGCACGCACTCGCCTCCGACGAAGCTGGTGTGATGAATGCGCGGGATCTTCTTCGTCTCCTTCTGGCCGCCGTACAGCACTCCGTCGCGCAACAC
GAAAATCCATCCGTCCTCGCCCGTCTCGACGATCTCCTGGGACGAATCGTGGATGATCACGCCGTCTTGCACCGACAACGCGAACTTCTGACGCTCCGCA
ACCGTGTCGCAGTACAGCACTGTTTCTCGCTCGAGCTTCGTTCTTGGGATGCCTTCAACTTCGACAGATTCGTCGTCGAGCCACTCCCAGAAGCTTGGCG
TCGCTGCTTGGCGCTTCCACTCTTTGTAGTACGCTCTCAAGTTCGCACCGTATCTGTAAAGCAAAGACAAACAAAACAAAAAGTCAGCAAGAGCAACAGT
ATGAACTAAAATCATGGAAACAACGAGCACACTCACCGATGCTTCCGGTCGCAGACTTCTAGCCAGCTCTTCTTGTCGACGACCGAAATGTTGCCTGCAC
TGTAGCCCTTCACGAGCTTCGGCGAGTACTTCTTCGCGAGCTTGACGATCTCGTGCATGTTCTGGTACGTGGTTCGTCGTTGAGAGCGCATGGTCTCCGC
GGTCATCTCACTGGGGGATCTCGCAGCAAGGGTCTTGGTCTTGGATGAGCTGGTATTCTTCTTGTATTATCCGACGCCGCAAAGCACTTGGGATTCGCAC
ACTCGGCAAGCAGTCTTCGTCTTCACTGTGTCGCTCAGTCTTTCAGTAGTTCGTGCAAACTACTTACTGAAC