Description :
From Genome Similarity Track
Location :
contig_47:452971- 454300
Transcript NameFunction/comments
g7912.t1myosin-like protein

Sequence
1329 bases(100 bases per row)
GAGGGCATCGAGGACATGACGGCGCTCAACTACCTGCACGAGGCCGCCATTCTGTACAACGTCAAGAAGCGCTTCCTCCAGGAGCTCCCATACACCTACA
CGGGGGACATTTGCATCGCCGTGAACCCTTATCAGTGGCTGCCTGAGCTTTATTCCGAGCAAGTGCAGTCCCAGTACCTCACCAAGGCTCGGAATGAACT
GTCGCCCCACGTGTACGCCACGTCCATGGCGTCGTACAACGACATGAAGCGCCACGAAATGAACCAGTCAATTCTGGTGAGTGGCGAGTCTGGTGCCGGG
AAGACCGAGACGACCAAAATCCTCATGAACCATTTGGCCTCCATCGCGGGAGGCTTGAACGACTACACGATCAAGAAGATTATCGAGGTGAACCCCCTAC
TGGAGTCGTTCGGTAATGCCAAGACGGTGCGCAATGACAACAGCAGTCGATTCGGCAAGTTCACCCAGCTCCAGTTTGATAACGCGGGCATTCTAGTGGG
AGCCCGATGCCGCACGTACTTGCTGGAAAAGACCCGAGTGATTTCCCACGAAGAGATGGAGCGGAACTACCACATTTTCTACCAGCTGCTGTCTGCTAGT
GACAGCCAGGAGCGGTGGTTTCTGGATGACGCCAACGAGTGCTATGCGTACACGGGCGCTAACAAAACGATTAAGATCGAAGGCATGTCGGATGACAAGC
ACTTCGAGCGCACTAAAACCGCGCTTGGACTCGTTGGTGTAACGGAGCAACAGCAAGAAGTTCTCTTTGAAGTGCTTGCGGGTGTACTGCACCTTGGACA
AGTGCAAATTCAGTCGAAGAACAATAATGAAGAGTCAGCCATTGTCCCTGGCGATCGAGGGACGAAGCATGCAACTAAGCTCCTCGGTATTTCGGCAGCA
GACCTGGAGAAGGCTCTGTGTTCGCGGCAGATCGCCGTCGCTGGTGATAAGGTGACGGCCTTTTTAAAGAAGGATCGAGCCGAGGAATGCCGTGGTGCGC
TGTCCAAGGCCATTTACTCTAATGTTTTTGACTGGCTCGTCGCAACGATCAATACGTCACTGGAGAACGACAGGAAGATGCGCCATCACGTCGGAATTCT
CGATATCTTTGGCTTCGAGCACTTTAAGCACAATTCCTTCGAGCAGTTTTGCATCAATTACGCCAACGAGAAACTCCAGCAGAAATTCACACAAGATGTC
TTCAAGACCGTCCAACTGGAGTATGAAGCTGAAGGTATCATCTGGAGCCATATCGACTTTGCGGATAACCAAGATGTGATCTCAGTGATCGAAGATCGCC
TCGGTATTATTTCGCTGCTTAACGACGAA