Description :
From Genome Similarity Track
Location :
Scaffold_76:45294- 49021
Transcript NameFunction/comments
g13511.t1XP_002899180.1 conserved hypothetical protein [Phytophthora infestans T30-4
g13512.t1KUF79019.1 serine/threonine-protein kinase drkB [Phytophthora nicotianae
g13513.t1hypothetical protein

Sequence
3727 bases(100 bases per row)
CGGTGGCGGTGCCCGGCATCTCCACGGGCATCTTCGGGTATCCGCGGGACTTGGGGGCCAAGGAGATCGTGACGGAGACGGTGAAGTTCTGCAAGGAACG
TGGAGATGCGACCAAGGTGCAACGCATTGCGTTGATGAATATTGACGACCCGACGGTGAACAGCTTCGTCAAGGCGCTGGAAGATGTCAAAGTGAGAAAT
GATGATGTGGACATTGGTGAGCAGCTTACTGGATTGAACATTCGCGATTGAGAGTAGGTGGGTTGAGGCTTTGATTGCTTTCCTATGGCTATTGTTTGGT
GGTAACTTTCTTGGGTTTGAGAATTAGTGAGTGGTATCTTTTTCAGATGGCCGTTCGTGGTTTTTATTCGAATGCTGTCAGACTAGGCGCGATCTCTCGG
GTTTTGACGTCTTCGATCTCCCGCACACCCACTCGAGGACATTGAGGTTTTCGTTGGAGAACTTCAAAGGTGCGGTGCCACATCCACTGTCACGATTGCA
AGCAAGCGTCCACTCGTAAAAGACGACCCAACTCACGCGACTGTCCGGACCGGTGAGAGACGGATTTTGAGGGGCTCTAGCGTCAAGATGACGAGGACGA
AGAGAGGGGTGGAGTTGTTCATTGGAGGTGGACTGCTTACGCTAACTCACGCTGAATCTTCTGCAGCTTGTACAGCACTTGAGCTGCAGTCGGCCGATCC
TTGGGGTTCACGGACACACACTCGTTCCCCAGCGCCACCATTGAGTGCATGGCACCAGGAGAAAACTGCACGCGTAGCTTACCCGTGGCCATGCGCTGGA
GGATAGCCAAGTCGCGCATTCGACGGCCCGATCCATCGCTCTCCGTCGCGTGGGAATACGGGAGCACGTGCATATCCAGCTCCGACAGCACCACCCCGAA
CGAGAAAATGTCGGCCTTGTCGTCGTACCGCTCCCCCATGAGCACTTCCGGCGCCATCCACAGCGAGGTTCCTACTCCAGCCGTCATGGTGTGGTCTGCG
CGCTCCCGAGACACACCAAAGTCCGTCAGCTTGGCGTCCAGGTCGGAAGTCAGCAAAATGTTCCTGGACTTGAGATCGCGGTGGATCACAACGGGTTTCA
TCGAGTGCAAGTAGGTTAGTGCGTGTGCAGTGTGCAGTGCGATCTTGACCTTGTCGTTGTCGAAGCCGGTGGGGTACTGCTGGTCATTGTACGAAGCAAG
AAGCCCCCTCAAGTCCCCACCTTCCATGTACTCCGTCACAGCGCATATATCGCTTAGCGCATTCCACGCTACGCCCACGAACTGAACGATGCACGGATGA
TCCAGAGACGCCATGAGCTTGACTTCAGCCAAAAAGTTGTTGACGTGGGGGACGCTTTTGCGGTTTGCCGGCAACATTTTCTTGACAGCAACGACGAGGC
CATTGAAGACGCCCTTGTACACCTCGCCGTACCCACCTCGGCTGATCAGCTCCCCGACCTCGATTCTCTCTCTCGGGATACGCGCTGTAGTGATACCATC
GTCAGTCCAGAGACCCACTTTACTACGTGGACGATGGTGTCCTCCTTGAGGCGCAGTTCCCTGTCTCGTAGCGGGGGAAGTGGCGTCGTGGTTTCCAACA
GGTGTTCGGTGAAGGTGGTATCCTCCGTCTTCTGGGCCGAGTCTGTTCTCTTCCAGCCACGCTAGACTTTCACCTTTGTCGAGAGTTGCCGTCGTTGACC
GTCTCCAGCAAGTGAAAACGGCGATTCCAAGCTCAAGAACCGAGACTCCGAAGGCTGTAAGGCTGGCAGCGACGATCGGTGTGCGGATATGCAGGATAAT
ACCGTAGGAGGTGATTCTAGCAGTGTGGGGGTAGAAATCTTGCCAGGACTCGCGAATTGCAAAGATGCCCGTGGCAACGGAGCACAACAGGAGCACGACG
ATGGAGGCAATTCCGATGCTTCTACTCTTCACACGAAGTGCCAGGATACGGCTGGTGATGGCAGCAAGTAGGGACCCGCCAGCTAGAAAGCAGAGCTTGT
TGCTTTGAAGAACTGGCAGGAACACGCCCAGCACAGCGAGCGCTGCACAACCAAGAGCCAGGGAGATGCAGCTGACAATCGCGATCGCGACATCCAACCT
GCTCACATGGATAGTGGGCATCTCGCTGCTCTCTAACTTCTTCTATCGCTGTCGTTGCTGCGTCGGCTTGAATTCGAAAGTGCGTCGTGTTAGACGAAGG
GCGCGCAGTCCAGCATCGGGACCACATAACTTAGCTGCGCACCCATCAGACCGTACAACACGGCAAGTGAAGTAACGTTTTATGCTGGTGCTTTCTGACC
TGGTCCATTCCCTTTTGCAGAAATCAAATCGGAGAACGACGTTGAGTGGTAAAGCGCCACCTCGCGTGCGAGCCGGTTGATGTAATGCGTTTCACGGACG
CGTTACCATAGCCTCAGAAATCCACTTTGAAACGGACAGCAAAAACACTCCCGAAAACTCAGCGGGCACTTGGCCTCCTCGTCCAGCCGCACAGGCCGTG
GAACTGGTGGCCGCACTCGAACGTAGCTGTGGTGACGGAGTCGAGTCTGAGTCCATCGAGACCGCACGCCAGTCGGCGAAGTCGTCGTTGAACTCGGTCG
TCCGAGGTGAGCGACATCATGGATCATCCGGAGACGTCGTGGACTCGGTGGTGTACTTGGGCACCGCGTTGTCCTTGCACTTGCCCAACAGGAAGGCGGC
GAACTCTTTCTCTCTTGGTCGTGAGCTCCAGGTGCTGCTACGCTTGACGGGGCTCAGCTTCTTGATGGCGGCCGTGCTCATGTCCAGCGAGAGGTGCTTC
ATCCGTCTCAGGCAGCGCCAACGGCTTGGCGGGCCTTAGGCTACTAGCCTTCGTTGGGGTTATATGCATCATGCCAGGTGGACTCCAGGTAGAGAGTTCC
ATTATCGTTGCGCTTGAGCTGATTCATGTTAACCGAGGTGACCAGCGTCACCAGCGTTTCTGACGTGCTCGAATGGCAGCATCGAACACACACTTTGCCG
TTGGCTACAGCATCCACACGCAGTTGTACGCAGCAGCAGCACTCAGCACGTACATCTAAACACACTAGCACTTGAAACGTCATCACCCACTGTCGACTGC
CATTGGATTTGTCAGTACTGTTGGTTGGTTGGCCTCACTTAGTATCCTATATCGCAGAGCTATCAGGTCGATAAGACGTACCCGATATCAAGAGAGGATG
TATTCTCGCCAGCGTTTATCTACGTAGTGCCAATTACAGTGGACTGGGTCTGCCCGCTCTTCACGGCGGTAAACATGCTCGACGTGGATTCCTCTTCAAG
CCGGAATATTATAGTCATTCCTTCAGCTTAGGATAGATACTACAGTACTTCTTTGTGCTCGCCTTGAAGTTGCTCCACATCTGTATTCCGTCCAAAAGAG
CATGTCGATCAAAAACAACCATTTGCCCAACCATCTTCAGATCCAAAAGTGAACTAATGCGCAAGGTCTTATCCAAGATGTCGTCTCCAAGTCGCAATGG
CTCGAAATCTCCTACCAAGTCCCCTCCAGCCACTTCTACAAGTGATAAAGTCGACGATTCTCTTGGTGGGAAGGTCTTGAGTCAATGGAAAGTGTCCGAC
AAGGGTCCGGAGCTGCTGGTGATGCAGGGAGATCTCACGCTGTGCTCAGCCGACGCCATCGTGAACGCCGCCAACTGCCAGTTGCTGCATGGCGGGGGGT
TGGCAGCCGCGATTGTACGCGCGGGAG