Description :
From Genome Similarity Track
Location :
Scaffold_12:452832- 454065
Transcript NameFunction/comments
Phyra_75393apo-8'-phytoene desaturase/dehydrogenase

Sequence
1233 bases(100 bases per row)
GGCAACAGCAGCACAAGACCGCACTTATATTATGGAAGAGCGCACCAGTTCTTTCGTCGAGCTCAAGAACGACACGCCCAAGAGCAACAGCCGCATGTCT
CGCAGTCGACAGAGCGCCAGCATGAGTCAGAGTCACGCCCGCAGCCGCGTGCTCTCGCACAGCACCAAGCCCTACACGGATGAAGACGCAAACGACACCA
TCTTGCGCGCAAATGCGCCGCCAAACTACACGGGCGGGTTCAACTGTACGTTGCAAAACTTTTTTGTGTAAAACGTTTGCGCTAACGTTTGCACTTTTTG
CAGCCATCATGAAGCAGATCAAGGCCAAGAACTACTACACGCAGCAATTCCAGCGCATCCAGCAGCAGACCAACATGAGTCGCCTGCTCTTCTTCTCGGA
CGTGGCCCCCACGTTCTACGAGTCCAACTACGTGGCAATCGCGCAAGAAACGTCTCTTTTGCGCGTTCGCGCGTGCTTCTTCATCGGGTTTGTGGGTCTC
CTCGCGCTCTATTTGAACGAGTGGCAGTCGGACAAATGGTCGGCAAGCGCAACAAATGGGCGCACAGATCAGGACGAAACGGCCATTATGGCCATGACGT
TCGGCGTCATGCTGCCCACGTTGGCGCTCGGCATTTGCGCAACTTTCACGGGACTGGGGCGCAAATACCTGGAAAACGTCACTGCGGCCGTGTTCGTCAT
CGTTGCAGTGCTGATGATCGCGAAAAAGCCCGTGGAGAAGGCCAAGGGGCCCATCATCCCGCTGCTGATTATTCTGATCCCGATCTTCGGCATCACGAGG
ATGCGCTACGTCAAGTCGTGCTGCATCGGCTGGGGTATTTTTTTCAGCTACCTGATCGTCATGATGTCGGTGCGCAACTCTCTGCCGAATCCCTCCACGT
TCGACTCGTTCACGGACATTTCGTACCAAGCCATTAACTACGGCATCACGGCCATTGGCGGAATGGTGTCGCAGTACCGACAGGAGCTTTTGCGGCGGCG
CAACTTCTGTTTGCACCTGCCGTTTTCCGGGACCATGGACGCCGACGCAGTGGCCGAGATCAAGACGGACAAATTCAGCAAAAAGACGCTCATGCACCGC
TGGTCGCTCAAGTTTCGCCACCCGGAGGTCGAGGAGTGCTTTTACCGGTACTGGTACCTCATCGACCCGTTCCCGTACGAGAACCCGAACTCGGGCTCGC
TGCACCAGGGCGTGTTCCGAACGATTCGGTTCG