Description :
From Genome Similarity Track
Location :
Scaffold_601:4528- 6031
Sequence
1503 bases(100 bases per row)
TTGCGAGCCTTCGCCCAGACGTATTTCGACGATATTTACGCCCATACGAAACCCGAGGCTGGGCGATATCTCGACGATCTCCACGAGGAGCATCTCCGGC
AGGTCATTGAGTGTCTTGAGAAGCATCAACTCTATGCGAAGCTCGACCAGTGCATCTTCGGTGCTGACGAAATCCCGGTGCTCGGGTGTTTCGTTGGGGT
TGACGGGGTGCGGGCTGACCCCGNNNNNNNNNNCCACGAAGGACTACGCGTAGCTCGCGCGTCCGTTACACGGTTGCTCAAAAGCGACGTTGAGTGGTCA
TGGGATGGCCAAGCAGAATCCGCTTTCCGAAAAATCAAGGAGAGCCTTCTCTNNNNNNNNNNAGAAGGTCATGGCCATCGCGGAGTGGCCGCCCCCACAG
TCGATAAAGGACCTGCGGAAATGGCTGGGAGTTGCCAACTACTTGCACAAGTACACGAAGGACTTCACGGAGCTCGCGCGTCCGTTGACACGGTTGCTCA
AGAGCGACGTTGAGTGGTCATGGCCAAGCAGAATTCGCTTTCCTCAAAATCAAGGAGAGCCTTCTCTCGGCGCCGATCCTGGCACTTCCAGACGACACCA
GGCCATACAGTGTCGTCTGCGATGCGTCTGATTACGCGATCGGATGTGCATTGTTGCAAGTCAACGAACGCGGTCGCGAGAGAGTTGTCTCTTATCAGTC
CNNNNNNNNNNTGCCGCTGCTCGGCCATTATCGCCGCGTTGTCGTCTCCGACCAGTCCAGCGTCTTTGGCTCCCAGGCTCCAGGCTCGGTTCCATCGATA
TCACCTTTGTGATGGGCTCCCGAAGTATCAGGTCCAGACAGTGATCCCGAGCGTGTCGTTGTCCCGCAGGACGAGGACTTGCGATATGTTCTCCCATACG
GTGTCCATGACCCTCTTGGTGTGGGGCATCTCCGCCGTGAGAAGACGTATGCGCTTCTCANNNNNNNNNNGCATGCGTCACTGCGCACAGCGATCCAGTC
GCCGCACCTTGTGGTTCAAGATGTACAAGTGGGTCTCTNNNNNNNNNNGATCCAGTCGCCGCACCTATCACCACGGATGGCGTGGTTGGTTTCTTTCATC
TCAGAGTACAATTTTAAGCTCAAGTACAAGCCGGGTTGGCTGAACGTCCTCGCCGACGCTCTCTCTCGGCGACCCGACTATGAGATCAACCATCNNNNNN
NNNNCGATATGTTCGCTCGTGCAAGATTTGCCAACGTGTCAAGCCGGGCTTACACTCGCAGGCACCCCTGCAAAGCCTGTTGGTCCCCAGTGACTGCTGG
AAATCGATCAGTCTCGACTTTTTCTTCAATCTGCCACCGACGGTGGCGGGGCACAATGGTGTGCTCGCGCATCGTTATCGATACTGTCTTCCGTCTTCAC
GGATTTCCGGACTCTATCGTCTCCGATCGTGATCCGCGCTTCACCACTGACTTCTGGGGTGCGCTTTTCGAAATTCTCGGAACTTCACTCGACACGTCGA
CAG