Description :
From Genome Similarity Track
Location :
contig_28:452754- 453767
Sequence
1013 bases(100 bases per row)
AATTTGGTTCCGGTGGAACTGAAGTTATGGTAGGGCGATCACTCCCTATTGAAGATAGTAGTATCAATCGAGATGAAGAAAGGATCGTTCATAATTTAGA
AACGCGACCCAGAAGCAACCAAAAATTTGACGACGCGAAAGGCTTAAGTTCAGAACCTGCCACGACCTCCAACGTCCCAAACAGTGGGAGCACAGAACGA
GGCCAGTAGTGACAGACGTAGATCAAAACGACAACGAACATCAAATCTAAGATTGAAAGACGATAATACTCAGTAGCGACTGATCAGACGCGGATTCCGA
GATCGATAATAGAGACCCTATGTGCCAAGCAGTGGGAGACTGCAATACATACTGAATTTAATGTCCTTTTAAGCAATAATACGTAGGTGTGAGTACTTCT
TCCAGTAGGGTGAAGATGAATAGATTGCTGCTGGCTATTTGACGTTAAACACAAAGCCGTCGGGTCAGTCGAGAGGTTTACAGACAACAACAGTGAAATC
TGTACCCCCCCCCCCCATAAAAATCCGTACCCTTTGAAGTGGAACTCACAAAGGCAAGTATAACAACAAAAATACGGCAGCCAATTTAAAGCATTTTAAG
CAGCTCAATGGACTAGATAATTAACGGACGGCACGTCGATCTGTTCCCCCACTCATGCATTTCGTCATTGCAGAGCGAGCCACCATGGCTCCTGAAACAT
CTTACACAGTTGAAAAAAAAGCGTGAAGCTTTAGGAAGCGTCAGTCGGATTGGCTGCAAGCCCACGGCTCACAAATTTGACATCCCGTTGACAATACTGC
ACGATTGGAGGATGTAAGAGAAGGATATAGCCAACTTCGAGGGACCGCAGACAAGCAAGACACTAAAAGGACAGGACGCAAAGAGCATTATACCTTTCGC
ACACGACATGGTGACCTACATGAAGGATCTACATCGCGAAGAATAGGTAACGTAAAATATTATGGTTTAAGTATTTTGCTCAAATTTTGTGAGGTGGAGT
GTCGAAATAAATG