Description :
From Genome Similarity Track
Location :
Scaffold_197:4527- 14056
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_197-snap-gene-0.18RING zinc finger-containing protein
Pytar_ATCC12531maker-par_contig_197-fgenesh-gene-0.1DEAD/DEAH box RNA helicase
Pytar_ATCC12531maker-par_contig_197-snap-gene-0.12Prolyl 4-hydroxylase
Pytar_ATCC12531maker-par_contig_197-snap-gene-0.19Serine racemase
Pytar_ATCC12531maker-par_contig_197-snap-gene-0.20Gene of unknown function
Pytar_ATCC12531maker-par_contig_197-fgenesh-gene-0.3Pseudouridine synthase, RluA family

Sequence
9529 bases(100 bases per row)
ATACGCTTGGCGTACACCATGGAGCGTCGCTGCGCGCTATCCGCCGCCAATATGTTCTTGTTTCGACTAGATACGCGGCCATCAAAGTGGACAATCTCGT
ACTCGGTCTCGGAGACGACGTCGGCGTACGCCGAGTGGAACGCGCGCTTGCAAAGTGGGCACGTCGGCTCCCGACGCCCGTGTAGAACCAGGTTACGCAC
CCACGACGAGAGGCATACGAGGCAGTAGACGTGATGGCAGCCCTGGATCATGACTGGATCCTCAAGTGTGTGGAGACAAATTGGACACTGGTCGCCGAGA
ACTGCGCGATTCTGGGCGTGATTTTGCACCTCTGGAACTGAAACCTCGCCAGCGGATAGATCCGCGCCTCCGTGCTTGGTTCCATTGTCGAGGAGCTCGA
TGGACAGCGCGTCCGGCTCGTACCGAGCGAGCCAGTCGCCGTCCTCATCAATCTGCGCATATCGCTCTGCGTCCATTTCCAGTGTGGCAGCAGATTGACA
GGTTGACGGGTTGACGGGTCAACTGCTTGACCCAGCAGTTCTATGTATGGCGGGTCGAGATTCGAAACCCATGACCCACACGAAAGGTTACACCAACTCA
AAACGTAACCTATGGCAGTCGTCAATTTCAGCCAATCAGCATCTTCCACAGTTGGTTGGCGTCGCTTGGCTTGATGACCGGGTTGAGGAGCTCACCATAA
AGAGGAAGAGCATGGCGGCCGACGATCTGCTCAAGGGCGGCAAGGCCAAGGGCAAAGGTGGCGGCGGCGGCGGCGCTGCGACGGGCGGCACGACCCACGG
CAAGAGCAATGGCAAGGGCGCCGGCGTCGGCGGCTTCCAGAACCTTGGGCTGAGTCCCGCGATTTTCCGCGGCGTCTTCGCCATGGGCTACAAGGTGCCG
ACGCCGATCCAGCGCAAGACGCTGCCCATCGTGCTCTCGGGCAAGGACGTCGTGGCAATGGCGCGTACCGGTAGTGGCAAAACGGCGGCTTTCTTGATCC
CGATGCTCGAGAAGCTCAAGGAGCACTCGAAGAAGATTGGCGTCCGTGCAGTCGTGCTCTCGCCGACCCGTGAGCTCGCCGTGCAGACGCTCCGCTTCGC
CAAGTCGCTGGCCAAGTTTACGAATCTCAAGATCTCGCTCATCGTCGGTGGCGAGGGCATGGAGTCGCAGTTCGAGATGATCGCGTCGAACCCGGACGTG
ATCGTTGCGACGCCCGGTCGTCTCATGCACCACCTCCAAGAGATCCCGGACTTCAACCTCAAGGTGGTCGAGTACGTCGTCTTTGACGAGGCCGATCGCT
TGTTCGAAATGGGCTTTGCCGAGCAGCTCGAGGAAGTGCTCAAGAGCATGCCCGCGGCGCGACAGACGCTGCTGTTCTCGGCGACGCTGCCCAAGGCCAT
CGTGAGCTTTGCGCGCGCGGGGCTCAACGACCCGGAGCTCGTGCGTTTGGATGTGGAAAACAAAATCTCGGAGAACCTCAAAATGACGTTTTTCACGGTG
CGCTCGGCCGACAAGCCGGCGCTCTTTCTCTACATGGTGCGCGACTTTATCCCCAAGGACGACCAGACCATCGTGTTTGCCGCGACGCGCCACCACGTCG
AGTTTCTCCATGAGCTGCTCCAGGCCAACCGCATTGACTCGTCGCTCGTGTACGGCGACATGGACCAGGCCTCGCGCAAGATCAACATTGGCAAGTTTCG
CGCCAAGAAAACCAACCTGCTCATCGTCACAGACGTCGCGGCGCGTGGTATCGATATCCCCCTGCTCAACAATGTCTTCAACTACTCGTTCCCACCAACA
GCCAAGCTGTTTGTGCATCGCGTCGGTCGTGCCGCGCGTGCCGGCCGCAGCGGTACGGCGTTCAACTTTGTGGACCCGGACGAGACGCCGTACATGGTGG
ATCTGCATCTCTACATTGGACGCCGTCTCGAGGACTCGTCGCCGCTGAACGCAAAGGCGTACGGACTCGACACGATGCAAGTGAGCGACATCCACTATGG
CGCGTTCCCGAACGAACTTATTGACCAAGAGACCGAGCACACAAACGACACGCTCGCGACGCACCCCGCTGTGCAGCCGCTCGTCAAGGTCTGTGCAAAC
GCCTACAAAATGTACACGCGCACGCGTGCGGACCCGTCCAAGCTCTCGATCAAGCGTGCCAAGGAGCTGCTGGTCACAAAGGTGCACCCGTTCTTTCTGG
CCGAGTACGTGCAGGCCGACGCCAAGATTGAAAAGGTCCAGTACATCGAATCGCTCCAGTCGTTCCGTCCACAGCAAACGATCTTTGAAGTCTCGACCGG
CGCCCACTCGCTCAAGAAGACGGCTCCGACCGTCGTGATGATGCAGACCAAGCGCAAGATCCACGAGAAGATTATCGTGAAGCAAAAGACCAAGGACAAA
GAAGACGACGAATATACGCATCTGGAAGGCGACGAAAATGACGTGGATGACGGACCGTACGTGAAGAAGGATGCAGCCAACGAGGAGCAGGCCCAGAAGG
ACCAGGAAGAAGAAGAGGGAGACCGCGAGCCGCCGGCGCCGCCAAAGAAGACGACGTTCCTCTCCAAGTTTGAACGCAAGCAGCTCAAGAAGCGCGTGGC
CGCTGGTGCCAAAGAGGAGGACGTGCTCAAAGAGTTTGCGGCCGCCAAGCAGGCCAAGACGCTGGCCCACGGCGTCGGATCGGGCGACGAGCCCATGGAG
GACGAGCCGGCCGACGACGATGACAGCACGAACCGGTTCAAGGACAAGGACAATTACATCACGTATATGAAAGAGGGCGAGTACATGACGGAGGAGTTCT
TGTCCAAGGGTGCCGATGGCGGCACGAATGCGTTCCAGGACTCGCGCATGGAAGAGGCAATCTTCGATATCAATCCAGATGAGACCAAGGAAATGAACAA
GAAGAAGCGCGTGCTCCACTGGGACACGCGCAAGAAAAAGTTTGTCAAGACGGCCGTTAGTGAGATCACGGCGACGGGTGCGATCAAGCGCCGCAACGAG
AGCGGTGCCGTGGTCAAGAAGAAGCACCAGCAGGGAGAGCTCTACAAGAAGTGGCAGCAGCGCAATAACAAGCGCGTCTTTACGGGTGGCGAAGAAGGCG
ATGACGACGGGGGTGATGGCAAGCGGCTCGACTATCGCCATGGCAAAAAGCCCCGGCTCGCTCCGGGTGCCGGGACTGGCGTCGCCAACAAGTACGCCAA
GAGCGAGTTGCTGGGCGAGAGCAAGATCCGCAAAGAAGAGGCCCGCAAGGCGCGGTCGCGTGGCGTGAAGAAAGTGCCCGGTGCCAAGCCCTACACAAAG
CGTGGCAAGGGCAACATCCGTGGCAAGTCCCATGGCGCGCCGTCGCGAAGCAAAGCGATTATCCGACGATAGATTCAATACTATACGATTAACACTCCTT
CTCGTCCTCGTCTTCTCCGTCGTCCTCTTCCTCATAGTCTTCGCTGGATCGGTGACGACGGCGTCGCGTGTGTTCCTGGGTCAGGTACGTTATCGCAAGA
CTCACGGGTGGCTTGGGCAAAAGCTCTCGGGCGAGCGGCTGGATCGAGAGCACTTTCAGGTCGCGCCGGTATTTGGGCGAGCCAGTGCCGCGATTAGCTG
CCGGTTGGTACGTAAAGGAAATATGGAGGCCGAGGAGTAGCTCCTCGAGCAGTGACGGCAGCGTCGGGTACTGGTGCAGGAGCTTGCGGAGCGCGGAGGC
AGATGCGCCGAGAAACGCCTCGGCCGGCTCGTCAAATAGCATGGCGTCACGCACGTCGGTGTCCATAAGCAGCGTGAGTTTGAGTCGGTACTTGTACGGG
ACGGCGTCAGTCTTGACAGCCGTGCCGCATGCCGGACAGGAGACGCCGATGCGGTCGAGNNNNNNNNNNNNNNNNNNNNNNNNCTGCAGCGCCGCAGTCA
GCGACGTCATGCAGCGCGGACACGCCGCGTAGCTTTGGGCACAATCGAGAAATTCAGAGCAATCAAAGGGAGATATCATAACGTCAGACGTACATCATGT
CGTGCAGCGCTGCGCGGTCAATGATTGCGCTTGGCACATGGACGTTGGTCGCGTAGCTCTTCATTTTGGTCGATTCCATCGCTGACCAAACCAAAGATGA
CTTTGATTGGCTGAATATATTAAGGTAGGATGCACCCTTTGGCTTTTGATTGGCTAATAATCTCTGATGCATGCAGTGATTGATGGATGCTGTTTGTCTG
AGCCATCATTCTGCAAGAAGATCCGCTGACAGAATGAGAGGCGTCCGCCAGGCCGTACGCTGCCGCTGGCTCTCGACGGCGGCGCCCATTCGTCCCAGCG
AGAGTCTCTTACGTGCCACGGCCTCGCAATGGCAGTCGCTCGCGACGAGTGACGTCGGCGCGGCGCTTGTCCGCGACGGCTTTGCCGTGGTGCCAAAGGC
GTTCCCGCCGAGCTTTACGCGCCTCGTGCGCGACGAGATGAACTTTCTCCACGCGACCAAGCAAATGTACGCGAACGCGACCCACATTCTGATCCACGGC
GAGCAGGCGCCGACGCTGCTGGAGAAGCACAGCATCGTCGAGACGGAGCTCGTGCTGCCCGAGATTCGCCAGCAAGTGCCGACCCTCGAGTGGTTCTTCG
ACTCGCAACAAGTTTTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAACGACTATATGGTCAAGCTCCAATACAACGACGGT
CACGGCGGGTGCTTCCCCATGCATTTCGACTCATATGGCGACGACGGCAAGTGCATCAGTGCCGTGCTGTACCTGAACGAGGAGTGGCAAGGCGGCGACG
GAGGCGAGATCGTGCTGTACCCGTTCCCGCAGCGACGAGAGCCAGTCATCGTGCGGCCTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNTGGACGGCGATCTCGTACTTTTCTCCTCACAGCACATGCTCCACCGTGTGATGCCAGCGACGAAACCGCGGTACTGCCTCACCACGTGGATCTAC
AGCTCGCCCGTCCCGACGACGATCACTCAAGCAAGAGCTCTTCAGTACCCACAGAGCGTGGCGCCCTCGTACGAGCTGCAAGTGATGGACAAGATCCTTC
GGTCTTCCTTTCGGCGCCACCTCGCCAAACTCTTCTACCGTGACGAGTGGACACAGTCACTCCTGGAATCACACCGTCTGACACGAGAATTCGCCAAGTA
TATGGCCACGCACGAGCAAGAAATGCAAGTGATCGAGGCGGCAACCATGCAAATGCTCGCCAAGTTTCGGGCCAAGGACCCTTCACAGCCGTCGAGAGTG
CCGGCGGATGCGAAGCAATTGTTTCAGTACATGGAGCATGACCAGTCATGCCGGGCATTGCTGAGGGACCTCGCGATCGCGTGGTTTTAGAGAGTGCACT
ACCAGCTTCGTACGGTACTCATTACTGTGTACAGCCGCGGGAGACAGTCTTCCACGTCGTGGGCGCAGCCCCCTGTATGTAGAGCTGGTTCGTGAGGTTG
GCGACGACGCACGAGTGGTTCGGCAGCACGACCATGCGGGACCCGATCGCCGGCGCGGGGATGCCGTCGACCTGTTGGATCCAGCCGTGCTCTTCCGAAA
GCTTCTTGACTTCCCAGCACAGCACCTCGTGGCCGTCACGCGTCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTCGGCTCGTGCTCGATCCGCTCC
AAGTCATTTTCCAGCACCGCCAGGCCGAAGCACTGCGCGCCAAATTTGTCGGGCGAGCCGGAACGAGGACTAGCGACCAAGACGAAGGAACACAGCAGCA
TGTGAGGACCCCGGCACAGCATATCACGAGGTTAATAGAGAAAGCGTACGCGTCCGCGCTGAGCACTTTGGAGCCGGCGTCGATGATGAAATAGTGCGAA
TTGGCACTCACGACGGTCGTGAGCACGCCGAGCGAGACGTTCTGGACGGTCGTCAAGCCCATGCGCACGGGCGTGCGGTCCATGAACACGTAGTTCCCCG
GGCGGATCTATGGGGGAACAGCGGCCATGTAAGAAAAGGAGCCTGGTTTGATCTCAAGCAAGGAGGAGTCTCACCTCGGTGATACCGTCGAAGCTCTTGC
GCGCCAACTCTGTAAGTGTGCTGCCACAGGAGACGGTCGGGACAGGAACGCCCGACTGGATTCGAAAGGGTGCATACAAGAGTCAAGTACCGGTAAGCCG
ATGGAGGGGTTCACCCAGAGAGAAACGTAGCCACCGGACCGATTGAATGGCGTCTCGAATGCGAACCATAATGGAGCGCTCTTGCTCGGCGACCGTCGCA
CACTCCTCCAAAGACGTACACGCATATGCGTGGCCTATGCAGGTACAACCGAATAGGTAAAAACACATTCCCATACTACGCTCGGGATACTACTACCGAC
CAGCGTGGGACAAGATGCCTTCGAACGCGAGGTGCGTTGACTCGTGGATACGCTTTGCAAACGCGAGAAGCCGTGGGTCGTGCTCTTCGATGCCGACGCG
GTGGTAGCCCACGTCAATGTGGAGCAGCACTTTGGGTGTGTACTCGCACTCGGCAGACGCTTTCTCAACGGCCTCGAGCCCCTCGAGCGAGTCGACAGTG
AGCCGAAACTCAATGCCCGACTGCTTTGCTGCCACCAGCAGCGCGGTGAGCTTTTCGACTTGCACGACCGGGTACGCCAGCAGAATACTACTGAGCCCGG
ACAGTTTGCTGTGGAAGAACGCGAGCGCTTCCGAGGGCTTGGACGCCGTGATGCCGCAGGCGCCGTGTTGCAGCTGCAGCGCCGTGAGCTCGAGCGTCTT
GTGGGTCTTGATGTGCGGACGCAGCGCCACGCCGTGCGCGTCCGCGAGCCTCTGCATTTGCTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTGATGCACTCGGGCCTCATCCACCATCACGCTCGGCGTCGCCATCCACTCGCGCATTGCTGCAGACGAAGACGAGGAAGAAGCGGAAGCGAAGGAAG
AGATCCGCAATGCTGGACATGGTTGGCAAATCCAATGGAATGTTACGCGAAGGTGGACCGAACGCTGATTCAACCACGAGGAGCTCCTCGCAGTGAAGGC
GAAAGCAATGGCGCGAACAGCCCAAGCCGCCGAGACCGCCTCGCATGAGGTGGCTCCTGAAGCGACACGCGCGGAATCTCTGAAGCGCCGCATTGTGAAC
TCGTCGGCGTATGGCTTCTGCGTCTTCGAGGCGGCGCAGTTGCCGCGGGTGCGACAGCTTCTGCTCACGAGTGCGGCGCTCGCCAGTGCCGACTCCACGG
GTGACGAGCAGCTCCGCGGCACGATCCTGCTCTCGGAGGAAGGCGTGAACATCCGACTGAGTGGTACGCGCCACGCAGTGGACACGATGAAGCAAGCGCT
GCGTGACGCCCACGAGGACCTCGCGAACATGGAGTTTAAGGACAGCTACTCGGAGCGGCTCACGCTGCCGCGGATGCTGGTCAAGATCAAGAAGGAGGTC
ATCTCCATGGGCGACCCGGACGTGACACCGGCAACGAATGGACTCGCCACCCATATCTCACCAGAAGACTTCAAGCAGTGGCTCGACGAGGACCGCGAGA
TGGTCGTGCTGGACACGAGGTAGGAGATGCCCAGTCGAATACGATGGCATACGGACACTCACTCGTCTGCGTATGTAAGGAACGACTACGAGGTGCGACT
GGGCACCTTTGAGAAGGCGGTCGATCTGAACATCCAGAGCTTCCGCGCGTTCCCTGCTGCCGTGCACGACCATCTCCAGCACGTGCCCAAGGACACTGTC
GTCGTCATGTTTTGCACGGGCGGCGTGCGCTGCGAGAAGGCCGCGTACACGCTGCTGAACGACGGGCGTGAAGCCGTGTATCAGCTGGATGGCGGCATTC
TCAAGTACTTTGAGCGCGTCGGCGGTGCCCACTACAAGGGCGACTGCTACGTGTTTGACGATCGCGTGGCGCTCACGCCGGCGCTGGAAGAGAGCGACGC
CGTCGCGTGCTTTGTCTGCCGCAGCCCACTCACGCGGGAGGACCAGCGGTCCGTCGACTACGTCGCGGGGCTCCACTGCCCGTATTGTCGCCACGGCAAG
CCGGAGATCCGGTCGGCGTCATCTTGACGACGCCGAATCAGGTGGTCAATAGATATGTGGGATGCCTGAATGGACACTACTTTTGGGGTTAATGGTACGT
TTTGGATTCAAGAACGTTAAAACGTGTAATACTTGCGAACGTAGACGCGTAAATAACGTTTTGTTACTTCAGAGCGATTTGTGTCAACTGTTCGTGGGAC
CCCTTCCCCTCGCTCGCCATCGGAGGTTCAAAAATGACAAACGCAACTGGACCACAGTCCCGGGAGAGAAAGTGTGGGTGAAACCTGACGAACAGACCGG
GCTAACGGAGCTTAGCATGCTCAAGTATGTTGGGTAATTCACCAGTGGGCGGACGCGCATGAGGGTGCCATTATGGTCCTCCTGTTGGACCGGAAAGAAT
GCCGACAGTAATTTGTGGATAACAGTTTTGGCAATAGGGGGGGAGATGATGCGGGTGAGCGATCCCCGTTTCCCCAAATTTGCTGGTTGTCTCGTCCAAT
CACACGAACGGAGTTCGCCCATCACGTCGTGGATTGGCTGCTAAATCCCGCCAAACAAACCCAAGTAGCCAATCAGCGTCGTCGCTCGCCGGCAGAGAAG
ACAGTTCCACACCCACTTTTTGTCATTCGATCTTGGGTCGAGGCTTCCTTTCTTTCTTTTGTGTGCTTGTTGGGGAGTTGTTGGTCGCTTTTTTTCCAAC
AAACTCCACATAGACGTTGGCTCGGAGACATCAGGCCGTTCCTCGCAAGACGCGGCGGAAGAGAGAAAGCGACGAAGTGACTGCCGCCGCCCTCCGCTCC
CCCTCCTCCTGCAAGCTCCCTCTCCCTCCCACCCATCCTCTCGTCCTCGTCCCTCTCGTCCTCGTCCCTCTCGTCCCTCTCGTCCCCTCCGCTCTCGCCG
TCGTATCTCCGTTCTTCCGTGGGGGATCGCGATTCCTTTGGCCGCTGCGCACCGCCCTCCCACGACGCCCGCCACCACGAACACGCACGCGCTCCACGGC
TTCAGCCGGGCGGTGGTGAGCGCCAACTCTCACGACAGCGTCCCGCACTCCCGCACGGAGTATTCCGACCGCCGAGAGCGCCGCACGTCGTCGTCGTCGT
CCGCCACGTTCCGCTCCCCTCATTCGTTGGAGCTGCCGCCACGGCAATCGACCAGCATGGATCGCTCGGGGTCAGCGAGTATCGACTCACCCGACAGCTC
CATCCAGGAAGCGACGACGCCTACGCCCACGTCCACGGACGGCGGCAAAGATGAGCGATACTTGGCGCAGCGACAGTCGACCATGGACAGCGCGACGCTC
GACAAGCTGCTCATGGCCGAGAAGCATTTGTTCCATGCCGGCCAGGCAACGCTCCAGGCGTGGAAGCTGATTGGACGCGACCCGAACTCGGATGCCGAAG
CCGCGGCCCACCCCAACGCGCAGGCGGCC