Description :
From Genome Similarity Track
Location :
contig_38:45260- 58427
Transcript NameFunction/comments
g7052.t1cysteine protease family C26, putative
g7053.t1hypothetical protein PHYSODRAFT_537011
g7054.t1hypothetical protein PHYSODRAFT_353509
g7055.t1hypothetical protein
g7056.t1hypothetical protein

Sequence
13167 bases(100 bases per row)
GACGAGCTGTGCTCAAAAAGCATGGTCAAGGCAAGGCAACTTCGTCTAAAATTGGGCGAGCGGAACTTATTTATCTGCCATCAAGTTTCCCCTTCGAGAA
CGCTGCTATCTCAGTGTTGCTCATTGCCCTCCAAGCACCATTGTGATGCGCTCCGGACGTCGCTTCGTGCCGGTGCGGAAGTGAAGATGCTCTGCCGCAT
TTACCCGTGTGTACACACTGTGGTAACGATGTTGCCGAGGACACGAGGCCTTCGGTCTGTGCTGTATATAGTCTGCTTTGCACCTACAAATGTTTCCAAT
ATAGGTAACGAAAGAGCTCTTCATATAAATGAATGCTGAAAAGAGTCGATACATGTAGTCATAGAGAATCTGTGTCCAGGCGAGCTGAAGCAGAGATTCG
TCAACTGTCTCCGAGTAGATGAGCCGATTAGAATGTATTTTCGCCCCAGCGAGCTCACGTTTGAGCCCAGTTACAGCTCGCAACGGCGAGCATTTGTCAA
AATCTAGGGTGATCAACCCCACCTTCAGCAATTCAGCTCGGACTTACTGTAGAAAGGGTTTTCACCACTCGCAGTGATCCATTTACTGCAGCATCTTTGC
CGACATTGCTCAAAACGTGTTGGATCCAGGTCAGTCTATGGATAGACCCAACCAGCTCGGGGCTCTGCAAGCGTGAGTCAGGCGGCCACGCCTTGCGCCA
GCGATGTGAAGCAACTGGTTTCTAACGATGGATGTTTGGCTGACGGTCGATCAGCACAAACTTGGTCACCAAACCGAGGCGATCACGTAGTCAACGCGTG
CATTCATGCAGGACTATTCCAGTGATGCGTCTGCAAAGGCAAGGACGAAGGCGTGACTCCGTTGTCGTCGGCAGCTTGATGCTGCACGTGTGCCGGCACC
GGACCGCAACCTGAAAACGACGCATCCCTCCGCGCCACAAACTGCACATTTTCACCACCGACCAGGGAGGATGGGCACTTCAAGTTGCGCAAACTACCGA
AACTTGTGTGCACCACTCCACTCCAGTAATCAGGTCAAAGCTCGTCGACGTCATTCGCTCAACTTCCTCGCTACGACCGAAGCCTCCCTCCGCCATGTTG
ACCCGATTCCCCCAGCGCTTGCGTCTACGTCTGCAATCGACAGACGCCTCGCGCGCACTGAGTTCGGCCGCTTCCTCGTCCTCTTCGTTGAAAGTTCTGA
TCATCGACGGATATTCGCCCGATGGCCGCGCAGACCTGGAGGCTGGTGCGCCAGCACGGCCGGCAAGCTGTACGTCAATCTGTTGAACAAGTCGGCGCCT
GCTGGAATGAAAGTCGCGTCGGATATCGTGTACCCAGCAGACAGCGATTTCAAAACGCCCGAACTATCCAAGGTGAGCTGACCGCTTGAATCTTCATCAT
TTCGTTGAGATTGTGGCAAGAAAAACTGGCCAAATTGTGGAATGCTCAGAGGGTTATTGAGCGAAGAATTGATTAAACGTTGCGTGTTCGTTGACAGTAC
CATGCAGTGGCGTGGACAGGATGCTCGCTGACAATTCATGATACCAAGGACGTCCGTGTTACCAAGCAGATCGACTTCGCCCAGAAGATCTTCGAGAAAG
GTGAGGGTTCAATGGACGCAGTGGAGGGGTCTTTATCATGATTAAAACAAGGCACTAATGTAGAGTTACATGCTGTTACTAGGCATCCCGCAGTACGGTA
GCTGCTGGGCGGCGCAGATCGCGGTGGCTGCTGCCGGAGGTTACTGCGGGCCGAACCCGCGTGGTCGTGAGATGGGCCTTGCTCGTAAGATTGCACTGTC
CCCCGAGGGTCGTGCACACCCGATGTTCGAGGGCAAACCGTCGGTTTTTGATGCATTCACTAGTCACAACGACGAGGTGACCCACATGCCTCCCGGCGGA
CTTGCGCTGGGTGGCAACGACTTCACGGCGGTACAGGCCGTGGCTGTGCGTCACAAGCAAGGAGAATTCTGGGGCATTCAGTACCATGCTGAATATGATT
TGCACGAGCTCGCAAGGCTCACGTACTGCCGCAGAGAGAAGCTTGTGGGTCTGGGTTTCTTTTCCGACATGAAGAGCGCTGACCAATATGTGGACGACCT
TGAGAATCTGCACATCGATCCGTCTCGTTTCGACATTGCGTGGCGCCTTGGAATAGATGCCGACGTCATGGACGAAAACATCCGCCACTGTGAGACGCGC
AACTTCATCAAGTACCTTGCGCTTCCCTACAAGGCGGTTGTCGAGGGTAAATAGGCACCGTTAAACCGCATTATTGCATTGTATCGCGATACAAGGAGGT
AATAGATGGTCAAGTGCTCACAACTTTAATCGTCGATGGAGATTATTGATAACCAGTCGCTTTCAAAAGTTCTCAAATCGCTTTGTATTAGCTCGCATTG
GCAACAAGAGAGGATATAACCCCTCATTCCGGCTGCTTATGTAGAAATTTGCTGGGTGCATGCGTTGCCTTGGTTCTGGCAATAGCTTTCAGAGCTTTGT
AGTGAGATACTAAAGGCGCAATCTTCACATCAGGATGCTACAAGCTTAGTGTCGTCGATATTGTGGCGATTACTTCGAAGTACTTTTAAGTGCACTACAC
TATAGTACTGCATGTACATGTAGTAGGAAGTAAAGACCCGGTGCCACAATAAAACTGCTACTGGTACGAATCTTGAACGTCCAGCGCATTTGAGCTTTAA
TTCGTAAGTCCGCCTGCCACCGCTCAGCGCTCCAAGTCGTATGCGCCGAGTGTCAGCTCTCAAGATTCATTGCGTGAGTTGCAGTGAAGTCTCAAAAGCT
TTTGCTGTTTTCTTTCGCTCTTTGCAACAACTTCGCAAGCACCGGTACTCCATGCAGTAGTTTTCAGTTTCGTAAATGACAAGCTAAGAAATCATTGTTC
AGTGGTTAACACGTTGAACGAAAATGCACGTGGATAAATGCAAAATGCAGAAAAGCTAACTTGCTACCCACAGAAACCACAGAGAGACGAGACGAACGTC
AAGCGCAATCAAAACGTGTTGTAAAGACGTCGAGATCTCGCCTGGCCCCGTTATCTACAGCGTACGCTTACTGCTTGCCGCTTTTCTTCTTGGCAGCCTT
CTGCATCTTGACGGCCTGCACATTCACCTTGACATCGCGGGTGAAGGGCAGGTAGGTGACGCCGCCCATGAAGGGGACCAGCACCTCCGGGACCTTGACA
CCGTTCTCGTCCTGGCAGTTCTCTAGAATGCAGCACACTGTACGCGTGGAAGCGCACAACGTCGAGTTCAGCATGTGCACATACTTCTTCTCGCGCTGGT
TCTCCTTCTTGACGCCGCAACGAATCTCCATGGCACGCGCCTGGAAGTCCGTGCAGTTCGAGGCCGACACCAGCTCACGGTACTCCTTGTAGGCAGGGAA
CCACGCCTCCAGGTCGTACTTCTTGACAGCAGCGTTGTTAAGCTCGCCCGACACGATGTTCACCACGCGGTACGGCAGGTTCAGCGACTGGTAGAACTCC
TCGGCATGACGCAGCATCTCGTCGTGCATGGCAGCAGAGCTCTCCGGGTCCGTGATGCAGAACTGCTCCATCTTGTCGAACTGATGCACACGGAAGATAC
CCCACGTATCCTTGCCGTGCGATCCAGCCTCTTTACGGAAGCAGGTGGAGAAGCCACCGTAGCGCAGAGGCAGCGAGCTCTCGGTGATCCACTCGCCCTT
GTGATAGCCGCAGATGGGCTGCTCGGACGTGGCAATCAGGTACTTCTCGTCCTCCCCGATGACCTTGTACAGCTGCTCGTCAAAGTCGTCGAGCTGCGCG
ACAGCGGCCATGCACTCCTTGTTCATGAAGAAAGGCGGCTTGAGCATCTTGTACTGGGCCTTCATAAGGAAGGCCGTGGCGTAGGCCATGAGCGCCTGCT
CCAGCAGGAAGCCGTAGCCCGTGAGGAAATAGGCGCGGTGTCCAGCCACCTGCACGCCGCGTTCGGGCTCGTAGCCATCGATGCGATGCAGCACCTCGTG
GTGGAAGTGCAGGCCGTCCTTCTGGATGGGGGATCCCCACTTCTTGACCACCACGTTCTCATCCTCGTTGCTCGAGACGGGCACAGTGGGGTCCACCACG
TTGCCGATCTTGGGCAGCTCGCGGTCCAGGAGCAACTTGAGCTCGTCAGCCTCCTTCCTCTTCTCGGGCAGCTGGGCAGCCAGATCCTTGCGCTCGTCGC
TGAGGGGCTTGAAGTCCTGCTTGGCCTTGCTGAGCTTCTTGATCTCCTGCTGCAGCGCGTTCATCTGCATGCTGATGGTCTCCACCTCGCCCTGCTTCTT
GCGCCACTGCTCGTCCAGCTCGATCACCTTGTTCACGATGTCCACATCTAGGAAGCGCTTCTGCTGGTCGGCGCGCACGGCGTCCGGGTCGCCGCCACGC
TCGGGACGCAGGCGGTTGATGTCGATAGGCATGTTGGAGTGCTTGGCTGAGGGTGCGTTGCTTTTCCACGTATGAGAGCGGGGGCCATCGAAGCGAAGAT
TCGCTCCAGCCACAGGAATAATCCTGGTCGGGCCTGAAAATGTGTAGTCGGTGGCGCATTAAGTAGCAACTAATCAGAGGCGGATATTCTTATATAACGT
TTAAAACTATGAAGTATTATGTTTTTACTTTAAAAAAATATAATAAACGGTGAGAAAGTCGAAAGCGTGCGTTGTGAGGGACAAACTAATTTCCAGCACC
TGGCACTGTCGTCGTCGCCACCCGACGAACCTGCGCCATCCTCGGAGACATTACCGGTTAGACCCTGCTTACCTAGTCTTCGCGGCAGTAGTTTTGCTTT
GATGCGTCTATATTGAATATGTGCGGGTTGCTTGCTTTCCCTGCTGAGAGCCCTCGGTTAAAAATATTGTTTTGTCGTAGCAAGAAGCAACCTGGATTCA
TAAAACCACTTCAAAGTTTCATCATTGCTTGCATATCGGCTGTTGCTACGGAGATCGTCATAGCAGCGTGCCTCGTTGGTGGTGGCGCTCCTGCGTGGCG
GCGAAACGATCCACAACTGTGTTGGCGTTCGTGGCGCCTTTCGTTAGTGTGGCCAGGTACGAAACCAACAGAGCGTCGTTGTACTCTTGCGTGAACGCCG
CGTCGAAATGCTCCGACTTCATGGCGGGCAGCTGATTGCAAATGCTCGAGATGTGGCGCAGCAAGTTGTGGTCTAGCGGGGCCTCGCCATCTTTCATGGC
CTGCAAGAAGCGCAGCAGCACGTCAACCTGACGGTCCAGCATCTTTACAGCGTCTCGGACGTTGCCCAGGTACGGGTGCACTGAAGCAGCGGCAGCGAAC
GTTAGGTTAGAATGAATGCCACATCCAAACAAATATCCTGAAGACGATGCACTTACACGACGACTTGCTCGCATCGCCAATCGGTGCGATCTTGGAAATG
TGGTCGATGGCGATACCTTCGGCTTCGGAGGTATCGATTTTGAAAGGCGCCTTGACAAAGATCATCTTGGGCACGCCGTTCAGCATGTGCAGCTCCGACT
CGAATAGCGAGATCGGCAGCTTCTTCTTGGTGCTCGGCCCCTTGGCCTCGGGGTCTAAGATCATGAACAGCGGGCTCTCATTGAATTCCATCACCTGTAC
GATAACCAAATACCTGTCAGGCCAACCTTCACCATCTCTACCAACCCACACGCCCTTCTCACCACGCGATGCACCGCCAGATCACTGGGCAGAGCCTTAG
CGCCCACCGTGTACCACCCTAGCAGCTCAAAGCCCGGGAAAACCTGAGAAACTGCAGCACCGCAAAACCCCGCGTCAGTTGCGCAGTCTCCTTCCTCTTA
GCGTCTCCACGTCGTACATTGCTGAATGCGCGAAGTGAGGAACTCCTTGTCGATCTGAATCTCTCCACTGGCGCCCACATCAAACTTCATCTCGAACGAG
TCGTATACGTCCACGTCCAGCCCCTTCTGGATACCGAAGAGCGCGCCGATGACCTGCGGCGCCTCCGTCTGGCTCAGCTGCGAGTTGCACTTCTGCCGGG
TCTGGTGGTCGGCGATGTTCACGATCACCAGCGGGTGGATCTGGATTTGCCGCTCGCCTCCGCCAGCGCCGCTGTCCTCGCGCTGCACCAGCATCTCCTC
GTCCTTCTCCTCTGCGCTCGCCATCTCCGTGTCCTCGCGCTGCATCTCCTTCTCGTGTTGATGTATGTCGACGATCCTTGGTGTAACGTGGTGTGTTCAC
AAATTCGGTGACTTGACTGTTGTTGTGGTGTACGCTATATGGTGGCAACAGTTGGACCGTGCCTCTAAATGATGTACGATTTGTGTTCATACGTTTTTGC
ACTCAATTGCCGACATGACGGCACTGAATAGTCAGTGACTATTCCGGTAACGCCAAGCTCGTTGAACAGGCCCTCAAGAAACGCAGTGCCGCGCTGAACC
AAATCCCCCCTCCGTTGCAGCATCGGAACAACGCAAACCGCCGCCGGGGGCCGCCGCCAACATGAGCGACCAAGTGTCCGACGACTTCATCTGGTCCTTG
GACGTACGCGACGACCCGAGAGGCAGGAAATTGATACATGACTGACATCTTCTGCGTCCGTTATATGTTGCTCAGAGCCTGATAAAGAAGGATGCGGGCG
CCGACGTGGAGGGCGACGCGGACCTCGTGCGCGCAAGCTTGTACACGCAGGACAACCTGCTGGGCTCCATGATCGGCAGTGACCTGGTATTCGGGCGTCG
AGAATCCGCCAAGTTTGCGCAGGATGAGGACGTCGCAATGGGAGGCTTCGGACGGCCCACGGGCCTCATGGGCTACGGTATCAACGAGGACGAACTGGAT
GATGACGAGACAATCGGCCCGATTGAGGAGCGCCTCCCAGCCAACTTGAGCGCCACGCAGCCAAGCAGCGGCAGCAGTTATTACGCCCGACAGTCCTCCA
GTCAGCTCAGTGAAGACACAGATAGGTCCTTTTCGTTCGCATCGGAGGATGACCACGGCATGGACCCTCTGTCCCTACCTTCACCGCAGAGGAAACGTTC
CACGAGACGATTGAGCGACGGAGATCAGGATACCTATGAACAGCGAATCGAGGCGTCCCTGGCTGGGTACATTACCAAGTCGCTGAACATCGAGTCGCGC
ATGGCCGCAGAGGAGCAACTGGATCGACCATTTACAATGAGCGACCTTGCTCATTTCAGTCCGCAGTTCGGGCGAGAGCTGTATCTCGAACGACTAGGGC
AGAGTCTGCAGGAGCAAGAAAGTGGAGGAAAATCGCTGGCTTCGTACCGACGAGCCTCCATGCAGCGGATGTCCACACCAGCAGATATTATTCGGCAAGG
ATGGATCATGAAACGCGGAGAAGTGGTCCCTAGTTACCGGAAGCGCTGGTTCACGCTCGCGTGCGTCGGATGCCGCAGGGACCGATGCTAACGTACGCCA
AAGACAACAATGAGACCTCTCCAGCTAAAATGATTGATCTTAGCTCAACGTCGCGCTGCGTGACTGTCACCGGCAGGAACGCAAAGGAGCACGAATTCAA
GGTAATGACATCTGCGGATTCCTCGAGGCGTGAATACTGCATGGTGGCAGCTTCCAGCTACGAGATGACGCAGTGGGTGTGCGCTATTCAAGCTGCCATC
AGTGCCGGAAACAGTTCTACGTTTGACGGCGCCACAGACTTCAAACAGCTATGGCACGAAGCTGGAATCCAAGGATTTTTGGTTCGATACGGTGTGCGCA
AGTGTAGCTCGCGGAATCGTCTTCAAACACGAGTCCTCGAGCTTAATTTTGCAGAACAAACCCTTACAAACTCGCGACGAGGAGAGACCCTCACGACATT
TCATTTCACTGATATTCGCGGCATTTCAGTAAGTAGTGTGCGCTCTAGCGGCGAGGAGCATGGTGTCAGTATCGATTTCCACGGACGGCATCGATCCTGG
CCAATTTTCTTGGATTCGGTGGAGGCTCGAGATGATTTGTTTGGTATTCTGCAGCGTATTGTTGGCAATGTGGTGTCGGGCGAGGACCTTGAAAAGCGGT
CGTCTCGGTTGACGCTCAAGACTGGTCACCTCGAAACAAAAAATGCTGGGCCCCACGCTACGCTGCGCGGTCGTTTATTTGTCTGCCTTCACGAAAACTG
TATCGTGTTTTATCCGGAAGATGGAGATACCAGTACACGGCCGTGGTATGTCATTGCCCTTAAGGGCCTTCGCGTTTCGGTTCGAGAAGAAAAGCGAATA
CTTTATATTGGACGGCTATCGTTAGCGTGCTCGTCCACAGCAGACTGTCGTGCCTGGTATGATGCCATCTTAGCGGCTACGTGCCTACCAGCAGAAATTA
TTGAAATCGAGCTAAAGGAGCGAGCGAAGATCCGCACCGTTTTCCAGGTGTGTGTGTCTCGGCTGCGGAAATTGCTCAAGGCTAAAGTGACGCCCGAATC
GAATGGACCACCGAAAGATCAGAAGACGGTGACTTTGTTGATCAGCAAGCTCTGGGAGCTCGTTTTCCCGGGAGAACCTTTCACGTCAAATGCCGATCCC
AAGTGGTTGGAGATTGGTTTTCAAAGAGGTGGCCCTGCGTCTGATCTTCGTTCAAGCGGTCTTCTTGGACTCTACTGCCTAATCTTCTTTGCCAGCTATC
CGTCGAGCGAATTTCAACGTATCCTGAAGCGCACACGGCATGGTGTGAGTGAAGGTAACATGAAGAATTACCCTCTGGCGATTGCGTGCATCAATGTGGC
ATCGCTTTTGACCGAAACGCTTGGTTTGGGCGACGCTGGAACGCACTCGGACGGTTGTTCGTTAAACGCGATGAAGACATACAGCCTTTTGGTTGCACAG
AGTGTCAGTAAGTCGAGGTCTTCAAAACCAGCAAGGGTGTTTTCGACGTCGCGGCGCCTAAGTGCTTACGAATCCTGGGAGGAAATTGTCGACGAACCGG
AGAACCACGTGTTTGAGACCATCTTCAGCCTTCTCTTCCCGGTTCTAGACTCGCTTTTCGTTGAAATGGGAGCGGTAAGTTTTGTACCTCGGTGCGTGAA
AAGGTGATGTACAAGCTGACGGTGCTGTTTGTTTGCTACAGGGGTACATGGAATTCGGTCAAGTCACCATCGCGTTCCGACAGCGCGTGAATGAGATTTT
CAACGCGCAGCCCAAGTCACTGAAGGAGCTTCAGAAGCTGGCGAGCGAGCCTTGCACGGGCACACTAGCGGTGCCGACGGTGTTGCAAAGTAAGCATCAC
AAGATAGGGAAGATTGGCTTGGGCAAGAAAATAGTGAGGGCGGGCGGCGTATAGCTACGACGAATGCAGTCTAGTCTTGCCACCCCACATAGAGATTTTG
AAACAAAGCCAATAGAAATGCCATCCACTTTGCGCGTTGAAGATGCATTGAAATGAGTTCCCGACAACTTACAGTATAGCATAAACTTCACGTGACCACA
GTCGTGGGTCAGGACGCTCCACCCCACACTCCGATAGATGCGGCGCTGCCACCAACGCTATTTGCTCGCGGTAGCTGAACTGGTGGAGGAGTACGATGCA
GATGCAAATGCCGACCCCTTCCGCCACCACGAGCACCACCTCCTGATCCACTGCCCCGTCCATAGTGGTGGTGGCGAGGTGGCTGATGGTGCCCAGATCC
TCCATGATTCACGGCCGAGCGGGCCAAGAAGCGTTCCCACGACAGCTTCATCTCACGCAGAAGCTGTACTGATTGCTCTTTTGCACGGCCCAAAGCCTAC
ACAAGAATTTCAACATGTCTGATTAGAAATTCTCGAGACCTCTCAAAAACGAGAATCCTTACCGATTCCGATGTGCTGGTAATCTGAATGTAAGCTTCTG
GCATCGTATGCGAAGAAATCTCCTTTTTGCCGTCACCCCGACCTTTGCTCCACTTGGCTAGCGACTGTGGCCACGGTCCAAAGTAACGCAACTGGGCACA
TGCAATAGCTTCGATCTTTTTCAGGTGGATGCCGCGCTCGCCGAGCAACTTTCCCGGGAAGTTAAACCGCCGTGACACGAGCGCCTCCGCGTCGACAATG
TCATACACATTCACGCGTGCAAAGAGGTGGCCAGAGGAAACAGACTCCTCGCCATCACCACTCAGCACAGCGTGCTTAAAGCTGCTGCTTCCGCTGCTTT
CGCTATCATCTTGACCCATTTCATCTTGTTCCAGGGCTGAGAGTCCAAGCTTCTTCATTTGCCGTCCTCTTTCTTCTAGCACTTTGCCTTCCTCTTCCTT
TCCTTGAAGCCGTAGGCATTTTCCGATTTGTTCTAGTTTCCACGAAGTAAAAGCGTCAATTAATATGACGACAAGTGCATGCTGGCTCACGAATTCGTAC
CAATACAAAAACCAACGTCACGTGTATCTGGGAAAAGTTGCTGACGAATGTCTTGTGCTTTTTTGTAGGCAGCAATAGCTTCACCATAGCGTTTCTATCA
ACAATCGCATGTCAATAATCAAACAAAACTGTCGGCTTAATCCACTGCCATACCTGATCCCGATACACACGCGCGAGATTAATAGAGATTCGTGCTGCAC
GGGGGCTGATGTCATTGAAGTATCGATCCGTGATCTGCAGGGCTTCCTTAATGTTTTCTTCTGCTCCACGCCAATCTTTCTGTTTCCGAGAGAAAAGTTG
TAAGAAAGCGGCCACATGCAGAATAATCGAGTTGGTAAACGAGACATACCGCTAGCCGCTTGAAATTGCCCATGTTGTTCAGTGTAGCAGCGGTCTCAAA
GCTCGCATTTCCGAGTCTGCTCCGGCGAATTCGGAGTGCTCGGTTGTACAGACGACCAATTTCTGCTCGCTGTGCTGCTAGCTCCACCTCGCTGACAACA
GCAAACAAGCGTTAGATTGACATGACTGGGTTTTCGGGGCAATTGATTTGACATACTCAAGTGCTGGGTTTCAAGTTGGTTCGAAAGATAGAGCGCCAGG
TTGTTCAGCGACTGAGCAACTTGAGGATGATTCTCACCAAGCGTTATCTCTCGTATCTTGAGGGATTGACGATACATGCCAGCGATGTCGGGCCGTGCCT
CTTCCTCCCCAGTTGTAGTACTCTTGTTCACACCCGTGGTGACACTCTCCTGGCTAGGGCTTGTCACACTTTCGCTGCTTGTACTAGATCTACTTGGGCT
CGGACTAGAGCCAGAACGAGCACCTCGGTGAGCAGTGTCATTTCGCCGCCCACCGCTTTTTCCTCCCCTCATGAGCTTTTCTCTCGATTCACGAGCGTCC
TCACGCAGTGCCGCCGACGGTGATCGACGTTTACCGGCGGTTGGATAGTTCTTGTAAAAGTTCGCTAAGTTGTTCAGGCTCGTAGCGTACTCTGGATGAT
TTTTACTTAGCACCCGACTACGCATCTCAAGCGCCCCTTTCAGCAAGCGCTCAGCGTGCTGCAGCAACCAAACATTATGTGCAAGATACCCCAGCGCGTG
CTGAGACAATTGCCAAACTGATTAAGCACTTCAGCCACCTGCGGATGTTCCGACCAGCCCAGTACCTCTCGTTGCAGCCGCAGCGATTCAAGATAATGGT
ACTCTCCTGCAACCCAGTCGGTGACATCGCAACAGGCGTAGCCCAAGTCAGTAAGTAGAAGAGCTTCTAGTGCAATGAGCTCACGTATTCCAACACAAGT
ACAGCGATCGTGTGCTGCAGCAGCAGCGACGGGAGGCTGTGGTTCCTCGAATGAAGGCAATTTTCCAGCAGCGACAGCTCTCGATCATACTTAGCTTCTT
CCACATCCCACAACAATGCTGCAGGATCATTTTCACGGTTCCCACATGTACAATGTAGCGAACGTGTCTCCCGTGAGAGCTGCAAACAGGAAGATACCAC
TTGAATACGCCGTCGTGGTTCCACACGCGCGCGAAAAATGAAGCGACACCGAACAACTAGATTACTGTACAGAAGCCCGTCCACAATCGAGGAATTTGTG
AGCGCTGCAGCACCTGCAGACCGGCGGCTACTCCCGGTACTGCTGCTTGTACTTGCACCAAAGCTACTGCTGTGGCGCTCAATGGATGGGTTGGGCGTTA
ATGCATCATCTGTGTACAATGCTGGCTCACTTTTTGATCTCATAGTACTGGTGGAGTTACAGGAACTTCACCAAGCTGATCACTAACAAGCTCTTGTTGT
GTACGACGATTGCTCTCACGCACCTGCTCAATGCTCTGTGACGTGAGCTCATGAGCTAACCGCATCGCCGATTCAATATTAGCACGTTCCTTATCGAACA
GCGCCAACGTGCCCTCAAAGCGGTAGGCATGTGAAGCCTTAGCCACGATCATGCAGTAATAGCGCACAAACGTCGCTTCCAAGTGAGAAGAAGCTCTTTA
CCCAGCGGAAAGCTCCTAGTTGGTGCGCCCATCGATGCCTCAACAAATGATGAAGGTGCAAACTTGGGCTTGAAGAGAGGGGCCCTGCGTCGGGGAAACA
CTCCTCGCCCATGCGGCCAGCTTCTTCTTCAGCAAAAAGCTGCACTAGATTGTGCATACGGTAACGATTCGTTTTCGTGTCGAACTCCACTAGCGACCAT
TGATGAAGAATCTCAAGTGCTACACTTGCCGAGGGTACACTCACTTCACGAGCTTTCACCTCTTCGCAGCTCTCTAGATCCAGCAAATCGTAGCTGTCAT
TCGTCATTGCACCATCATTGTCGAAGCCGAATCCATCCATGTTTGAAGCTGGGATCCAAGACTACGCACGGAGGAAAACGTCATCGTCACGACTACGACT
TCGGTGGCTCTTGGCGTACGCATGAGCAGGGAAGATCGATGAGGTTGAAGCACTTGAAGTACTAGTGTTAATACCCGCTGAACCACTTAATGACGAAGAC
ATCAAAGAGTAGCCGCTACTCCCTGCCAACTTGCCAGCAGCATTCTGCTCCGTCAAAACACTGGAAAGCACAGCATCTGCCGCTTCGATCTCGAAGCTAC
CCCGAAAAAATCCAAACGCCATGAACGCTAAGCGCAGTGGCTCGTCCAGGTGACAGAAAGATGAGCGAATGCAGCGATCCACACATTCTTTGTGTCCAAC
CTGGTTGAGTTCTCTGATTGTTTCGAACCTGTGCTCATCACGCTGGCACACAGAACGAGAAGGGTGTACGTAAGATAAAATGACAAGTAAGTCACAGCGA
ACCCATTCAGGCTTACTTACCTCTAAGTACTCGATCATACGCTCAGGTGTGACTGTCATCCGTGCGT