Description :
From Genome Similarity Track
Location :
Scaffold_986:4526- 6081
Transcript NameFunction/comments
Phypl_g11930hypothetical protein PHYSODRAFT_337039
Phypl_g11931hypothetical protein

Sequence
1555 bases(100 bases per row)
ACCCACGGCAGAAGCGTCCCCGTCGCTGCGACACTAGCATCGCGCATGTCGCTCTCGAAGTTCGGGTGTGCCTTCAAAGAGGTCGGTGTACCACCACCAA
ACTGCTGAGCTCCAACACCAAATCAAAATGTTGTTTCACACAAGCATCCGTGATTAGCACATACGAAATTCCATAGGAGTGCCCACACTCCGAACAGGTT
GTCGCAGTCAATTCTAAAAGTAAGTGCACACCAATTATGAGTACAACCAGTTGATGATCCCGTGTGTTAATAACACAGTGTTGTGTCTCTATTGGTAAAT
CTCATTCATCGCCTGCAGCGGGAATACTCGGCTAAAGGTGAGCGCTACGCGCTAAGTGTGGCCAGCGCCCCGGGTGATCCTCACGCGCTCACGTACCCCA
TCGGATCATAAATTTGTACTCGATCAAACTACCAATGACCCCATCCTCGTCGCAGAGCTCAGATCGGCCGTGATCGACACCTTGCCGTCACCGCCGACCG
AGCCGTCGCCCACACTCACCAACACAAAGCCGCCATTGCCGCCCGTGCTCGCGCCACTGCTCAGGAACCGGTTGCCGGAAGACCTGGAACTCGCCCCCGG
ATCGAGTCGCCCAACCCATCGAACACGCTGATTCCGCCCGCTGCTCCCGCCGTCGCGTCGATAAATCCCGAGTTGCCATCGAGCGACACAGCGACATCCG
ACCGCTTCTCTGCGCCGATGTCGACTtcgaactcgagcacgagcggcTCGATTTCGATGGGCATGGTCACGGGTGGCACGACGGGTCGGTCTGACTCAct
gagcttcagcagcgggAGTCGGTGATTTGTTTGTTCACAGCGGGGTCAGCAGCGCTACAACGACAACCAACAGCCAGCCCGTTGCCGCTGATGTTAGCGG
ACGGGTGATGTTCGTCGTTAGCACGGTCTCGAAGaccggcggcgacgtgggGATCAGTGGCGGGATGGATTCTGTAGATGTGGGTGGTGGCGTGAAAATC
GCGAGCGGTTCCGGTTTGAGTGCGATGAGTGGGTCGGTGCGTATCGGTAGCGTGGGCTCCGGGTCAGTCTCCGGCAAGGTGAGCGGGTCTgtgttgctgt
cgagcgGTGCGTCGTCGGGAGGGAGCTCGGGCAGCGTGTCGGTGCTGACATCGGCTGCGACGAGTGGAGCGAGTGGCTCGATTGTCGTTCGTGTGGGTTC
GGGAGATGCCGACGTCGGAGGCGCGGTGGAGATTGGCGGtggcgcgagcagcaagtgaaTGCCGGTACTGGCGGCCGTGTGTACGTGGAGGGTGGTAGTG
CACCGCTACTGGCGGAAATGTGGAGATAGCTGCGGGGTTTGTCAGTGCCACAGCGTCGGGCATCGGCGGTAATGTATTGATCTCGAGCGGGACTGGCAAT
AGCGCAACGAATGGCGAGGTGGCTCtgtcgagcgcggcgtcgggCTCTGTGCTGACGAGCAAGCTGAAAGCTCAAACCGACATCATCACGAATACGGGAA
CAGGGGATGAGGCCCGTAAACACACTCGCCAAGCCGCCCGTATCGCGCCTGCGAC