Description :
From Genome Similarity Track
Location :
Scaffold_71:4525- 5587
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_11803Avr4-associated TDF-like protein

Sequence
1062 bases(100 bases per row)
AGCTCTACAAGGACGCCGTCATGGAGGGCGGCAACCTCGTCGTGTACCACGGCGGCGACTTTGCCGGACAACAAGCCTTTGTCGCCGACGCCTTCCGCGC
CGCGTTCCCAAAGGTCAACCTCACCATGGTCGTCGACTACAGCAAGTACCACAACGCGCGCATCGACAACCAGCTCGCGACCAACTCGCTCGTCGCGGAC
GTCGTCGCACTCCAGACGCTGCAGGACTACCCGCGTTGGACGAAGGAAAGCAAACTCCTCTCGTACAAGCCCAAGGGCTTCAGCAACGTCTACAAGGGCT
TCACGGATCCCGACGGCGCGTGGCTCTCGCACGGCGTCTACTCGTTCAGCTACTTTTACGACGAGGCGCTTTTGCAGGCCAAGGGTCTCGCGCCGCCAGC
GACCGCCAAAGACCTCGCGGACCCCAAGTACGCGGGTCTTATTGCGTCTTCGTACCCGCATGACGACGACGCGGCTCTCTTTGTGTACGACCGCTACGTC
AAGGCGTGCGGCTGGGACTGGGTCAAGAAGATGGCGGCGCCGCAGATTTACATTCAGCGCGGCTCGCACATGGCCGGCGTCACCGTCACGGCGCAGACCA
AAGCGATTGGTGTCGCGGGCGGCCCGTCGTACACCAAGACGACCAAGGCCATTATGGGACCCAACGCGACGTCCGACTACCTCGCGTGGGGCCAGCGCAT
CGCGATTCTGAAGTAGGCGCCGCACCCCGCGGCTGCCAAGCTCTTTGTCAACTGGGTCGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN