Description :
From Genome Similarity Track
Location :
Scaffold_16:45230- 47787
Transcript NameFunction/comments
Sapdi_VS20SDRG_05866hypothetical protein
Sapdi_VS20SDRG_05867hypothetical protein
Sapdi_VS20SDRG_05868hypothetical protein

Sequence
2557 bases(100 bases per row)
GACGTCGACGTGCAAATTCTGCATGCCGAGCACGAGCGAGACGGACGGCGTTGCGTGCTCATCGTCAAGACGCGGTGTGATATACCGGCGCCACTCGTTG
TACGACTCCATGAGCGCGTCCGAGAGCGGGGCGTCGCTTGTCGGCCCGTCCTGCGTCGCATCGAGCCGCGGCAAATGCGTCTCTTCGCTGATCATGAGAA
TGTCGGCAAGTGGGCTCTGCTGCAAAATAGCCTCGATGGCAGCGTGGGCTGCGGTGCACGCGCCCAGAATCACGTACGGGTAATGCCGTGGCACAGCGCC
CTCCGTGGCTTCGGCCGCTTCTAGTGCAAGATTGTGCGAACTACAGTGCATCGACGGTCATACGTACCAGCTTGCTCGATGACGATGGATGGTGGGCGCT
CGTCGTTGCGGCTCCGACCGCCCTGCAGGCAGAGACCAGAGGCGAGGCCCGCCCCCAGCGCGACGGCCGCGCGGCGACCCACGAACGCTCCTCGCAACAT
TTTTATTTCGTCGATTGGCTCGTATCCGGACGACAGGCCGGATACCCAAAAGATCGCCGCCTCTTGTGAATTGTACCATGACGTGGCACAACAGGAGAAG
GCCGTTTCGAGACTGCGCCACTTTGCGCTGTTGTTTCTCAGCATCTAGTTGGACTCTAAGATTTGTTGCAGAAGCGTGACGGTGTGTGCCGGTGGCGATG
ATAGCAATGAGAACCCAAGCTTATTGCTCGGACTCGATACTACGAGTAGTACACAGGAGAGGGTCGCGTCGTCCAATGTGTCGTCGAAGGACGTGAAATT
GTTTCTGCAAATATATACTACTTTTAGGATAGAGAGTGTATAAAGCGTTGCAGTGAAGGATCTCCCGCGAGATGGCTACGTTAACTGCGAAAATACGTGT
TTTGTTTGGCGCTATGCGACAGATGTTGAGACTTGACGTTCAGTTTTCACTCGGGTAGCAAACACCATCATTCGCACTCGACGTAGGTATCCTCCGAGAG
CTGAGAGAGGTACGTGGCGCGGTCCGTGTACGTGGAATAGATGGCAACCGACGCACTTAGCGTACAAGCCGCCAAGAGGGCTACTAGGAAGGTCGAGGTT
GCACTTTGGCAGGTCACGCTGACGCTGGTCGCATTCGCCGCAAGCATCTTCTGCACGAGGTTTGCTTGCGACGGCGCCGTCACAATAAGCCGCTCGACAA
TCACCGGAAGTGATTTCGCGCTGCAGTACGATTGGCTCCACGAGTTGAGTGTCATACCATCTAGCGCCATCAGAAGCTCCGTTGCCAAGATCAGTAGATC
GTCGTACCTGCGACCGTAACGACAGCAAACGCGACGGCAAAGACGGTCCAGGCCAGCATCGCCGACACCGTTGACAGCCCGAGGATGATGTACGTTGTAA
AGACGCCGAGAAACGTCAACACAAAGTGAGCAATCGTGAGCCCGTCGGGCCATCCACCTTGAATCGTCAAGCCAATCGTTGAGCCATTGCTGTCGGGTTG
CACGGAAATGTCCATATTGGGGGCGCCTCGACGGCGGTCAAAGCCGGTGTCCAAGCAGATCGGCGCGTCTACGTAACTTAGCAACCTTTTTCTCTATCGA
AGCTACACCATACCAGAGACGATTGCGCCACCGGATGAGCGCTGGGTCGAGCTACGACGTTGTAAGGTTGGCCGACGCTCCGAGACCAAAGATACACGTA
CTGCATGCACGCGGCACCCGAAAATATCTGGGTGCCTCCGACGATGAGCGCAACGAGCGCTGCCGCCACGAATGTGACCTTGACGGGCGTGAGCCGCGAG
TAGCGTTCGTAGACGCCAATGTCCCATTGGTTGCTCCAGGCGTGCGGCGTCGCCACTTCGCACCCGAGCCGTCCCATCATTTACAAAAGCAAGGGCGACG
TTTCAGAGACGTTTCCGACGCCTTTCTGCAGTCAAAGATCTACGCGACTCACCACGTACGAGGCAGCTGCAGGTCCGCTTGATTCACTGCCACCACCGAC
GTCTCCCCCGAAGACCTCATTTTAGTTGATTAAGTGCCTGTATATACAGTACTAGTACTAGTACGTGTTTACACTCCCGCAACCGAGCACTCGTGGGCGT
ATCCATCTTGGGGCGCTAAGTGGTAATAGCTTTGTCACGGAAGCGAGATACCTCTGTCATGGAAGCGAGGCAGTTTGAGCGTACACCCAAGACGCGCAAT
AGGGGAAATTTGTGATGCCACTGACTGCTCTGGGTTCTCGCCAGGTGCGCACCAAAGCATCCAGCGATGAATGCCCCGGGATTGCCGCCTACACGATGCA
TGTTCCAGCGACCAACGCAACTGCCATTTGAAACGGATGAGCACGCGACCAAAGCGGAGCTCGACGCCCGCGGCGCTGATCAAATCGCACGACATTTCGA
CCAAGCAGCTCATGGACGACGCGCTCGTAGACCACGATGTGAGCGAAGACGGCGCCGACTCGGACGACACGGACGCCAAGAAGCAGCGCAAGGACGCCCA
GCGCATGTACCGCATCAACTCGTACTCGTCGCTCAACAAGCTCAACAAAAAACCCGC