Description :
From Genome Similarity Track
Location :
Scaffold_149:4521- 5546
Transcript NameFunction/comments
g7046.t1XP_008911953.1 serine/threonine protein kinase [Phytophthora parasitica INRA-310

Sequence
1025 bases(100 bases per row)
ACATACGGATCGCACAGGTGGAACGCATCCTTCCGCACTGGTCGCTTCAGGTACAAGTGAGCTGAGCATCGATGTATTCCGGCAAACTTTCCGCATTAAT
CTGTTCCATCGCCCACTATGGAGAAGATCTGCTCGACGGCTCAAGCTGCTGCGCACAGACCTGGTGGCGACTCGCCGAGACCCCTGCAGGCTCACGGGTA
ACCCAGCACCAAGACGCCAAATGACAACATACGATTAAAATTAAGATTAGCGGATATGGCAGAGGATACAATTATTGCACAAACTGAACCATGGCCTGAC
ACTAGCTTCAGTGCAGTAGTAGCGGATGAGAGAGCACTTCAGACGTGGTCAGGCGCTGGCTCGGGTCACGCTTGAGTAGGGCCGACACGAGAACGCACAC
CGCCTCGGAAATAAACGAGGACATCTTCCACGCATCGACAACGCGGCGGACACCCAGCCGCAGGAAGTCATCAAAGTCGTTTTCGTTCTCGGACGCGCAT
TGCACCAGCGGCGACCCCGTGAGCATGATGAATAGTGCAATACCTAGAGACCACATGTCGGCGCACATGGGTGAGTATTGTTGGCCCTCCACCACCTCGG
GGGCCATGTAGTACGCCTTGCCCACCACCTCGAAGCACGTGCGATCTGCGTCGGTTGCGAGGCCAAAGTCCGAGATCTTACACACGCCGCCACGCAGTAG
CACGTTCTCCAGCGACACATCTCGGTGTGCGATGCCGTTCGTGTGCAGGAAGTGGAGGCCGAGTGTCACCTCGCGAAAGAGACGCAATGCTTCTTGCTCC
GGCACTCGGCCGTTCGGCGAGCGCTGAACTCGGTCCCAGAGGTCTCCCTCGGAGCAATGTTCCATGACGACGAACCACGACTCGTTGTGCAGGAAATCTT
GCCGGAAGTGCACGATGTGTGGGTGTGGCGGCAGCGCCAGCAGTTTGGTGATGGCTCGTCGCTCCTGCCACGGGTTGTCGGCGTTTGGGTGTGCCTCGAG
CAGTCCCGCGGCTAGCTCGAGCGAG