Description :
From Genome Similarity Track
Location :
contig_43:452084- 453901
Transcript NameFunction/comments
g7554.t1OWZ09343.1 Proton-dependent Oligopeptide Transporter [Phytophthora megakarya

Sequence
1817 bases(100 bases per row)
GCTGGGCCAACGTGTCATTCCCCAATTTGCGGCGTAGAGCTCAAGTCGCCTCCGCCCATGGCGCCCAACTCCGCCAGCAAGTCGGCGCTGCAAGATGCCG
GGGAGCAGACGAACCTGCTGCCCGTGAAGCGCTCGGAGGCCGCGCGTCCGCAGTACCGCTCCATCATCGTGAGCGTCTGCTCCTTCATCCTCGTGACCGA
GTTCTGCGAACGCCTGGCGTACTACGGCCTGTCCGGGTCGCTGCCCATCTTCTTCCACCGCAACCTGGGCCTCAGCACGGTGCTGGCCACGGAGCTCAAC
TCGACGTTCACGTCGCTGTCGTACCTCACGCCGCTGCTGGGCGCGTACGTGGCGGACCGCCACCTCGGCCGCTTCTCCACGATCGTCGCCTTCTGCTCGC
TCTACATCGCGGGGCTCGCGCTCTGCGTGTTTGCAGCGTTGCCGGCCGTGTCGTCGCTGCCTCTCTTCATGCTGGGGCTCTTCGGCGGCGTGGGCTTCGG
AGCGGGAGGCATCAAGCCCAACGTCGTGGTGCTGGGCGCCGACCAGTTCGACGTCGACATTCCGGCCCAACGCGCCGAGAAGGACAGCTTCTTCAACTGG
TTCTACTGGGCAATCAACGTGGGCGCCACCTTCAGCTACGGCGTGCTCACCAACTTGGCCGTGAACGGCCTGCCACCCTATATTTCGGCCGACTATGGCT
TCTTCGCGTCGTTCGCGATCCCGTCCGCGGCTTTCGTGCTGGCGGCGGTCGTGTTTTATGCCGGCAAGGCGCGGTACCGGCGCGTGCCGCCCAAGGGCAG
CGCACTCAGCAAGTTCTTCTCGGTGTTGGTTCAGGCCGGTTCACGCTCAACTCGCGGCAAACTTGTGCTCAGTGGCGGACTGGCCTTCGTGCCGGGTATC
GTGCTCACGACGGCCTCGTACTTCATCCAGGATGACTTTACGCACATGGCGGTGGCGCTCGCTGGCGCGGGTGCTGTGGCGTATGGCACGTTTGTGCTCG
TTTTCTCGGGAGCTGCGACGGACTGGCTGAGGCTGGCGACGCGCACGAACGGCGGGTCGTTTTCGTCGCAGGAAGTGCAGGATGCGACGCAGGTCGTGCG
TCTCGCGCCGTACCTGGGCATCATTATCATTTTCTGGGCTGTGTACGGCCAGATGAACTCGAATTTTGTCGTGCAGGGCTGCCAGATGGACCTGCGTGTG
CAAGGCAGTGAAGGGGCTTCTGGGAAGCCGGTGCTGCTGTCCTCTGCCATGCTCAACGTGGTGGACTCGGGCGTGATCTTGGTCTTTATCCCCGTGTTTG
ACCGATTGCTGTACCCGTTGCTGACCAAGATGGGCATCTACCCGACGCTGCTGCGGAAGATCGGCGCCGGTCTGGTGTTCGCAATGCTGTCCATGATCGC
GGCTGGTTGGACGGAGCAGATCCGGAAGAGCAGTCCCATGATCGAGGGCGTGTCTTCCAACTGCAGTGCGGCGGGTGAGACTCTGCCCATGTCCACGATG
AGCGTTTGGTGGCAGACGCCGCAGTACGTTCTCGTTGGCGTGAGTGAGATCCTGACGAGTATCTCGGCCTACGACCTGTTCTACTCGGAGGTGCCCGAGT
CCATGCGCAGTGTTTGCCAGGCGCTCAACTTGCTCACGACGACGCTGGGCTTCATTGTGGCAGGAGCGCTGAACAGCATCTTCTCCTTCTGGGTCACGAG
TGACCTGAACGACGGCCACCTCGAGTACATCTACTACATGCTGGCGCTTCTGGTTCTCGTGCTGCTGGTGGCCTTCATGTTCGTATCGCAGTCGTTCGAG
TACCATGTGCCCCCGCC