Description :
From Genome Similarity Track
Location :
contig_43:452038- 453855
Transcript NameFunction/comments
g7919.t1OWZ09343.1 Proton-dependent Oligopeptide Transporter [Phytophthora megakarya

Sequence
1817 bases(100 bases per row)
GCTGGGCCAACGTGTCATTCCCCAATTTGCGGCGTAGAGCTCAAGTCGCCTCCGCCCATGGCGCCCAACTCCGCCAGCAAGTCGGCGCTGCAAGATGCCG
GGGAGCAGACGAACCTGCTGCCCGTGAAGCGCTCGGAGGCCGCGCGTCCGCAGTACCGCTCCATCATCGTGAGCGTCTGCTCCTTCATCCTCGTGACCGA
GTTCTGCGAACGCCTGGCGTACTACGGCCTGTCCGGGTCGCTGCCCATCTTCTTCCACCGCAACCTGGGCCTCAGCACGGTGCTGGCCACGGAGCTCAAC
TCGACGTTCACGTCGCTGTCGTACCTCACGCCGCTGCTGGGCGCGTACGTGGCGGACCGCCACCTCGGCCGCTTCTCCACGATCGTCGCCTTCTGCTCGC
TCTACATCGCGGGGCTCGCGCTCTGCGTGTTTGCAGCGTTGCCGGCCGTGTCGTCGCTGCCTCTCTTCATGCTGGGGCTCTTCGGCGGCGTGGGCTTCGG
AGCGGGAGGCATCAAGCCCAACGTCGTGGTGCTGGGTGCCGACCAGTTCGACGTCGACATTCCGGCCCAACGCGCCGAGAAGGACAGCTTCTTCAACTGG
TTCTACTGGGCAATCAACGTGGGCGCCACCTTCAGCTACGGCGTGCTCACCAACTTGGCCGTGAACGGCCTGCCGCCCTACATTTCGGCCGACTATGGCT
TCTTCGCGTCGTTCGCGATCCCGTCCGCGGCTTTCGTGCTGGCGGCGGTCGTGTTTTACGCCGGCAAGGCGCGGTACCGGCGCGTGCCGCCCAAGGGCAG
CGCGCTCAGCAAGTTCTTCTCGGTGTTGGTTCAGGCCGGTTCACGCTCAACTCGCGGCAAACTTGTGCTCAGTGGCGGACTGGCCTTCGTGCCGGGTATC
GTGCTCACGACGGCCTCGTACTTCATCCAGGATGACTTTACGCACATGGCGGTGGCGCTCGCTGGCGCGGGTGCTGTGGCGTATGGCACGTTTGTGCTCG
TTTTCTCGGGAGCTGCGACGGACTGGCTGAGGCTGGCGACGCGCACGAACGGCGGGTCGTTTTCGTCGCAGGAAGTGCAGGATGCGACGCAGGTGGTGCG
TCTCGCGCCGTACCTGGGCATCATTATCATTTTCTGGGCTGTGTACGGCCAGATGAACTCGAATTTTGTCGTGCAGGGCTGCCAGATGGACCTGCGTGTG
CAAGGCAGTGAAGGGGCTTCTGGGAAGCCGGTGCTGCTGTCCTCTGCCATGCTCAATGTGGTGGACTCGGGCGTGATCTTGGTCTTTATCCCCGTGTTTG
ACCGATTGCTGTACCCGTTGCTGACCAAGATGGGCATCTACCCGACGCTGCTGCGGAAGATCGGCGCCGGTCTGGTGCTCGCAATGCTGGCCATGATCGC
GGCTGGTTGGACGGAGCAGATCCGGAAGAGCAGCCCCATGATCGAGGGCGTGTCTTCCAACTGCAGTGCGGCGGGTGAGACGCTGCCCATGTCTACGATG
AGCGTTTGGTGGCAGACGCCGCAGTACGTTCTCGTTGGCGTGAGTGAGATCCTGACGAGTATCTCGGCCTACGACCTGTTCTACTCGGAGGTGCCCGAGT
CCATGCGCAGTGTTTGCCAGGCGCTCAACTTGCTCACGACGACGCTGGGCTTCATTGTGGCAGGAGCGCTGAACAGCATCTTCTCCTTCTGGGTCACGAG
TGACCTGAACGACGGCCACCTCGAGTACATCTACTACATGCTGGCGCTTCTGGTTCTCGTGCTGCTGGTGGCCTTCATGTTCGTATCGCAGTCGTTCGAG
TACCATGTGCCCCCGCC