Description :
From Genome Similarity Track
Location :
Scaffold_672:4520- 6208
Transcript NameFunction/comments
Phyta_totarag10078ATP-binding Cassette (ABC) Superfamily

Sequence
1688 bases(100 bases per row)
TGCTTAGCGGCGACGGTGCCGGTTGAAACGGAGGGATAGCACACCAATGACGAGGATCTGCAATACGACCGAGTAGCCCGCCAAGATGATCATGTCCTTC
ATGACGTTGACGTTGTCCATGCCGTACTGCTTGAGCAGGCCCCACGACTCCTCCGTGTTGACCGTGGAGAAATGCTCGTACATGAAAGACTCGAACGAGT
ACGTGTGGAAGGCAATGTAGTAGCCCCACTTCCAGTACACCGGCATATCTTCGAACGGCACCATGAAGCCTTCGCAAAGCATGAACATACCGAAGAGACC
GGCGCCCAATGCAATGCCCATGATGTAGTGAGGCACAGCGGCGCCGAGCAAGTGCATCAGAGACTCGGCGGCGATAAGCGACAGCGTCAGGTTCAGGAGG
AACGTTCCGAATGAATGCACGTGGGCCAGGAACACCACGATGACGGACGCGAGCACGGAGATGAGAAGAATACCCGGCAACGAAGCCAACAGATTGGACA
TTGTGTAACCAGTGAGTGACAGCGCATACGCGCGCATTTCTCGCTCCATGACTGTTCGGTGTTCCAACaaagctggaagagctgcgacGGACATGAACAC
CAGGAAAGCTTGCACGTAGAAGAGCAGCGGCACGATGGACACGTCCTTGATGCCGGCATTGGAGCTCAGGTACATGGTTCCCACCATCAATGACAGCAAC
ACGTACATGAGCACACGCAGCCAGAACACACCCGGATGCCTCCAATTGTTGGTCAGGTTCCGCTTGACCAACACGACAAACTGGTCCATCGGCCACGGTC
GCatggccttgagcagctctgGGTTGGCCAGGTGGTCACGGCGAGCTCGATCTCGCACGACGTcagcacgaagacgctggGGCTCGGCACTTTCCTTGAG
TGAACGAATGAATggctccagcttcaagccGTCGTGGAAGTTAGTGTTCACCAAGTGAACAAAATACTCCGCCGGGTTCGTGTACATCGGACACACGTAA
cccatggagaagaagtgAGCAATAGCAGCATTGGTGGGGCCGCTGTACACCAGCTCGCCGCTACTGAGAATGACGAGGTTGGTGAGCATGCCGTagatgg
acgacgagggcTGGTGGATCGTACACACGACGTTCTTACCGCCCTCCTGGCACAGACGTTCAATATACTGCATGACACCACGAGCAGAGGACGAATCCAA
GCCGGAAGTCGGCTCATCAAGTAGCAACAACGCAGGgtccgacagcagctccagagcaATACCGAGACGTTTGCGTTGACCAGACGAAATGCCCTTGTGG
AAGATGTCACCGACACGGGCGTTGGCGCACGATCGCAGTCCCATGGCGTCGATCACATCTTGAACACGCGCTTCACGCTGCACGGGGGGCATGTGGCCGG
GCAGACTCAACCCAGCACCAATCTGCAGGGTCTCCAACACAGTGAACGCTCCGAGGAAGGCCATGTCTTCCGACACGTAGTTCATGATGGAGTGGAAGGT
GCGGAGGTCACGGGGCTGGCCGTTCACCTCCACGAGACCTTCCAGATGCACGCCTGAGCCTCCCGACAGCACTCGGTCCGCGAGCATGTCCAGCAACGTG
GTCTTACCGGCACCGGAGGGGCCCAGGATGGCAGTCAACTCTCCCGGTCCCGATCGACCCCAGACATTGTTGAGGATCTTGcgaggct