Description :
From Genome Similarity Track
Location :
Scaffold_803:4520- 5877
Transcript NameFunction/comments
g17702.t1hypothetical protein

Sequence
1357 bases(100 bases per row)
ACTGGGACCAGGCGAACGATATGGCTGGTGGGAAGATCACTGTTCGGATGACACGAAACGGATTGCGATGGTTCACGGAGCGGTGAACAATTGTCGGACA
GACATCCTTTTGGATTCTGGAGCGTCAGTAAGCATGGTGAGTTTGGATCTTGCGCGTAGACTCAAACTCAAGTTAAGCTTCTGCAAACAGCTCCGGGTAT
CTGGACTGGGTGGCGTTCCGACCATCATCACCGCGAGTGCTGAAGTGAAAATCACTTTAGGTCCAAGAATTGTGTATGTCTTGGAGCTCTGGGTCGCGAA
CATTGGTGAAGGTGTCGACGTGTTGCTTGGAATGAATTTCATGTATTCCGCTGGAGTGCGACTGTGCGCACGAGAAGGATTGGTGCAACTTCCGGATGAA
GAAACTGTGTTGCTATCAGGACGTGGTGCGGATCATTACCACAGAGGTTTGGACCTTCCGGTGAGACCGCGTGAAGAGCTCTTCCTGCGCCCAGGTGAAC
ATGCTATCGTCCGGATACATTACGGACAGAGCAATCCACAACGTGATGTGGTATGGGCTGGTCGGGGAGACCGATGGGTAACCCAGATCATCTATGCTGC
TAGATCGTCATCAAAGTGGTGAACATTTCCGGAAGGTGTCTTAGCATTGACACTCGGACGCCGGTTGCTCGGATCATCGGGTTTGGCTTCTTCCCGAGGG
CAGGACGTTTTGTCCGCCCGGGTCTCCGAAGGTATCAGGAGTGGCAGACTCTCATCTATGAGAATACCGAATCCAATCAGATGCGTTTACGTTCTGAACG
ATTTGAGCAGATGATGAGGGACGCCGAACCTCCTTGCGTCCAGAAGTCCGAATACTCATGGCCGGCTAAGCTATTGGTTCGACCGCTTCCTGGAAGCGAC
CAAGTTCACATGGTGCAACTTCAGGAGCTGCCTCGTGTCTTACGCCCGAAAGTGGAGGAAACTCTTCCAGATGAAGTCATCGCAGAAGACACCGTAAAGC
TGAAAAAGGACCCTGAGGTTGAGGAAGTGCCACGTCCGGAAGATACTGGCGACGGATGTCACCAAGGGAGTCGGAGGTCATACCAAGGGTTGAAGAACGT
TTGGAAGGCGCAGAACTTCTGACGGACGACGTGGATTCGGACGGAGATGAATTCTTTGATTCGATCAGTCTGAATGAAGAGTTTCCGGATGAAGGTGCTG
ATGATGTGAACGATTGTCTGGATGACTTGTCAGGATTGGACGAACTCCGGAATCAGCAAACCCAAGCCATGCTCTCTACCCCAATCCAAAAGTTGGAAGT
CGAGTATGAGAGGTGCATGCGTCTGAACGCAGAAGAGCTGGATTTGGAACCCGCTGT