Description :
From Genome Similarity Track
Location :
Scaffold_2694:452- 2697
Sequence
2245 bases(100 bases per row)
TGGTAGTCGTATCCGGGAAAAGGACAGTCCAGGTGATGGCCGTCACTAGGTCCAGAGGAAGGATTGGATCCAGCCCCCAGATCCTCGAGGAAACATTTGT
GAAGAGAGTCCGCATTGAGCGGATCCTCAAAGCACAGAACGAGGAAGCGTGGATCCTGGGACTAAAGAAGTATCTGATGGGAGATGTACGAGACTTAAGT
CGGGAGGATGCCAAATCCTACAGCATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCTACGAAGAGAGTCCACGAGGA
TCGGGATGGATTGATGAGATTGGTGATGCCAGAAACCTTACAACAGGAGTGTCCTACACCACTACCACGCTAGCTGGGAAAGGCGGAACATTCAGGATTA
TGAGTGCGGACCTAACCAAGAGATCGCGGGAGATGTTTCCAACTGAAGAGGAACTATTCAAGAGCGTACAACGATATTTCGGTGAAGGGCGTGGATTGTG
TGAACAGCACAACAGGGGCAGCCCAACAATCGAGGGGGAGTCACCTGGGAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGGATCATATCCCC
TCGTTGCCCAAGTCGTTCAAAGGAAACACAGAATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGATAGCCAAAGCGAGTGCGTCTAGAACTGCGC
AAACCATTGCTGAATCATACGAGGAGTGTGTTTTCCGAAGATTTGGAGCTAGTGAGATGATTCGGCATGATCGGGAGCCAGGCTTTATGTCTGATTTCTT
TCGAGCTTTCAACCGGATCCTGGGGCAGCGACAGCAAACAATCATGGCATATCGTCCCCAAGCTAACGGGTCGGCCGAGCGCATGGTGCAGACGATCACG
AGAGCACTCGAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCC
GGGGTGACACCCCATTTTACTTGGTACATTGGGTGGGATCCCAAATTCACCCTGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATC
CAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCTAGATCCCAGGTGAATGAACGACTGCGGAGTGCGATACAGGATCGAGCGGATCGACA
CAACGAAGACGCCCGTCCACATCAAATCCAAGTAGGATCGCAGGTGTGGCTTTATTTGGATCGAGTGAAGGAAGGGTACGCCCGCAAATTGGCCCATCTA
TGGCACGGACCGTTCCGGGTGAGCGAGAAGATTGGAGAACATGCGGTGAAGTTGGAAACGGTAGGGACCGAATATCGCTTGTTCCCTGTAGTACACGTAT
CCAAGCTAAAGTTGGTCAAGGAATATCCGGATTTCGGTGGATGGATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGG
ATCTCGAAGCCGACGGGGTCGAAGTCGAGAAGATCACCGACATGAGGTCGGGGAAGCGAACTAGATACGGACGGATTTACCGTGAATTTCTGGTGTATTG
GCGTGGATATGACGAACCCAGTTGGGTAGACGAGGCAGATCTGAACTGTGGAGCATTACGCTATGATTTCTTGAGGGATCGTACGAATCGTAACAGATTC
GGCGTGATGCAGTCTCATGAAGAAGAGTAGGGAGGGGACCCATGGATGTGAGTTGGTCATGTCGATGGGAGGATGAAGAAGGGCCCACAGGAAGGGTGTG
GGCCAGGAGGAGGAGGATCGCTGATGTGAGTTGGTCACATCGGAAAGAAAGAGAAGACGAATCCACAGGGGAAGGGTGGATTAGGAGGAAGGAGTGGATG
TTTATGCATAAGCGTGACGTTTTACGTGTGAGGAGTCCTGTTTGATTTCAAGCACGAGCCTTCAAGGGCCCCAACTATACTGACCCAATTGATCCTGGGT
CATTGGCGCTAGATCCGGATGAAATCCAGGCGCAGATCCAACCGGATCCGGGATCCAGCCCAGATCCAGGTGTACGCTGAAAGGGTGGATCCCGCCCAGA
TCCAGGTGTACGCTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCCCGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCC
TGGCCAGATACAGGTGTACACTGAAAGGCCCGGACTAGATTTCTC