Description :
From Genome Similarity Track
Location :
Scaffold_2288:452- 2686
Transcript NameFunction/comments
Phyag_g12303hypothetical protein PHYSODRAFT_497752

Sequence
2234 bases(100 bases per row)
CCTTGCGCTCCTGTATGCTGCAGACAGTGTGAGATTCTCACCATCGACCACTTTCTCGTCTCAACAACGACAGCGCGCAGTGGAGATTTTACGAGAAAAA
GACCGAATCGAGTATCTCCCTGACACGAATGACAACGAGCTTGAGTCTGGCGTGCAGCGGAATACGTTCACTTCATTCCACTGCTTCCGGAACCACCACT
TGTGTGACCGGTGTTTGGCTATGAGACCTGACAAGCACCAAGCATCACACCAATGCACAAATTGCGGCCACCACGGCAGGTAGCCTCGCCATTCTAACAA
AGCCATAGTTCTCGTTTGATTCCCCTTTATGCTGTATCTTGTTTGTAGTCTTGGCTTCCTTCGCGTGGAGCCTATCCCCCCCCACCGTACGACGACAGGG
CTTTGTCGTTTTAGCCAAAGTGAGGTTCCTACCCAGTTTTCCGGCGGATGTagccgctggagctgaaggctGGCTTGCAGACGTATCGCCGCCCGACAGA
ACGGAACTTCCCCCTTTTGATGATGAGGTATCCCGTTACAGCAAACAGCGCGAACGCTGCGACTACACCGTCACGCACACGTGTCGTCATAGGCAGCTCC
GGACGCATACTGAGCGACACACTGACGACTGCAAGCGTAGCGAGTGCGGCCTCCAGAAGCATGTTCACGAgactgtgctgctgttggaaaTTAAACGGTG
ACTCGTCCCGCTTGTCCGGTGCGAAGTTTCCGACGAGCAAGTCGAACGAGTCCTGGCGAATGCCGTCCGAAAAGTTGTTGAGATAATAGCGAGTAACCGA
GTTCACGCCGTCCTGCAGAGCACCTGCGATTGTCCGTCGTCCTGTTCGTGTGAAGTCTGTCTTAAGCGCGCCCGTGCCAGCATACATCCTGCTCACATAG
TCTGCATTGTCAGCCCACGCATTCTTGAACACGACTTCAAAGCTGTTGTAGGGCGAGTCCAGCACACTGCTGCCCTTGCCGCTGAACGGGTAGAGCTGCA
TGGCCATGAGTACTGTACGTCTTGCAAACAGACTCATCACGACGTTGGTGCGATCTAAGTTGTCCATACAGTTTACTCGGAAAACACCGCGTTGGCGGGA
AAGCAGTCGTCCTTCGCCGTCACACTCGAACCACCCATACTGCGTGAactgctcctccacctccgtcaTGAGTTTGGACAGGTTGTGCCATGCCATCTTG
CGACATTCATGGTGAAAGTCGAACCAGACATACGCGACGGGTTCCGCAAAGAGCTGTGAAATCGACGTGGGTGCCGACGGTACCGTAATGTGGAGCGAAG
GGTGCTCTTTGACAGGCATCGATGCGGACGCCTGCAACGACGGAGTAGTCGCCGGTCCAGATACCTTATCACTGTTACTGGCTGTAGACGCACTAGTAgg
acttgctgcagcagagcctACTGCACTCGAAGGGGTGTATCCATTGCTCCCATTGGAtccaggagcagaaggcAGCGAGATGGACAAGCTCTTGTATTGA
CGAGGCGACATAGCGTGAAGCGCAGGAGACGCAGGCatcgacggagctggagcagaccCGACCGAGCTCGTTCCATCGCCGGATTTCGACAGCAGGTTGT
ACTTCTTGACGTACTTGCCGAATGCTGAGCCGAGTTGGGCCTGGTCTCTCACTGTAGCACTCTTTCCAGTCTTGTCAATGAGGTTGACGCACGTGATGTG
TCCGTAGCGCTGGATGAGGTTGTCCATGTGCGCGCGGAATGCCAATTCGTTCCAGTCCACGACGCTCTCATGGCCGGAGAAGGCGTAGCGTGTGCGTGGC
ATGTATTTGAGCGTGACCATCTGGTCCCAATACAGCGGGATACTGCCACGCACCTGCACGTACGAACACAGCGCTCGGTTCGATTTGACCAGTAGCATCT
CCGTCTCGGCGAAGTTGGCGACACATCCGTCCTTGTCCACGCCGCGCACGTTAAAGCGGGTGCCCACTCGTCGCCAGCTGCGTCGTGTGAAGAACAATAT
ATCGCAGCGCTGGCCGTTGACGTCGCACTTCTTGATGACTTTGACGAAGCCCGAGATGACGGGGACGATCCAGTCGCCAAGTTCCAACTCGATGAATTTG
CCCAGCACCGGTTTGTTCCAGAAGAAATCCTCCTCTGCACGCGCGTACAGAGGCGATTGCCGTTGCGCCgctgaggaggacgaagctgACGCCCGTTTTT
GAGCCGAGAGCGTCAAGTCCAAGTCGTAGCTGAA