Description :
From Genome Similarity Track
Location :
Scaffold_941:452- 2255
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_941-fgenesh-gene-0.0Sodium/hydrogen exchanger

Sequence
1803 bases(100 bases per row)
ACCACTAGCAGCAGATCGTGAGAACATGGAGTCGGCGGACGAGCAGAAGCGCTGGACCGGCGTGGAGCTACTCGCGTGCGCCGTGACGCAGCTGCTGCTC
GTGAACGTCGCGTACCGGATCGACCGCCAGAAGCGTGCGCCACTACTCTCCACGTCCGCATGGGCCATCTTCCTCGGGCTCGCGGTGCGTCCATGCGCCT
ATGCATAGACACATATGTCTATGGGTATGGGTATCGCCTGGTGACTCTATTGACTGACATGTGTGCTCTCCTTTCTCCCTTGTGTCCTCACCTCAGTGCG
GCGGGATGCTCTCCATCATGTCCAAGACGGTGAGGCGTTTTGCATTATCTAGCATCATTGCACACATACAGACACATGCGTTATCATTGATCTAATGTTT
GTGCTCTATGCATTTCTATCGCTTAGCGCGTGCACAGCGCCGGGCTGGACCCGCAGATCCTTTTCTTCGGGCTGCTGCCGCCGATCATCTTGGAGGCGGG
CTTCAATACGCAGCGCAAGGGCTTCTTCTCCAACTTCCTGGCGATCCTGCTGCTCGCGATCGTCGGCACGCTCATCGCGACGTTCGCGACAGGCGGCATC
CTCATCTGGCTCGGCAACATTGGGCTCATCACGCAGCTCACGTCGGCCGAGGCGTTCCTCTACGGCTCGCTCATCTCGGCGATCGACCCGGTGGCGACGC
TGCTCGTGTTCAAGAAGTCGAACGCGCCGCCGCTGCTCTTCAACCTGGTCTTTGGCGAGAGCGTGCTCAACGACGCCGTGGCGATCGTGATCTTCACGCT
CTTCAAGGAGTTTGTCGAGAGCGGCAACACAGAGGTGAACTTTGCCGTCGCGGCGTCCATGCTGTTCCAGTTCGTGGGCATCGGCGTCGGCTCCGTGGCA
CTCGCCGGCGTGATCTGCTATTCGTCCGCGTACATGCTGCGGCACTCGGACGCGGCGCTCAAGGAGCACCCGACGTACGAGATCTCGATCATCCTGCTCT
CTTCCTATGCGAGCTACGTGACCGCGGAGCTCTGCGACCTGAGCGGCCTGCTCGCCGTGTTCTTCAGCGGCGTGTTCATCCGCCACTATCACATGTACAA
CATCTCCAAGGCGAGCTCTTTCGCGTTCAAGCACCTGCTCTCGACGCTCGCGTTCCTCTCGGAGAACTTCATCTACCTTTACCTGGGCATCAGTGTGTTT
GCATTCCGCGACTCGCTGCTCTGGGACTGGGGCTTCATCTTCGCGACCATCGGTGCCTGTTTGGTAGCAAGAGCACTCAACACGTTCCCGTTGTGCTCGC
TGGCGAACTTGGGCCGCAGCGCGCGCCGCAAGATCCCGTTCGCGTACATGCTCGTGATCTGGTTCTCGGGACTGCGTGGCGCCATCGCGTTCGCGCTCGT
GCTCAACGTGCAAACGTCGAACCCGGACCACGCGGCGATCTTGAAGAGCGCCACACTCTTCACTGTGCTCTTCACGACCGTGTTCTTTGGCATGGGCACG
AGTCCACTGCTCGCGCGACTGAACCTGAGCGGCAGCAAGGACGAGGGCCACGGCGAAGGCGCCGCCGACGAGCCCGAGATCCCGCTGTCCAGTGACGACA
AGTTGCTGCAGCACCTGCACGACGCCCACGCGCTTTTCCAGGTCTCGAACGAGCACCAGCACCTGCTGCTGAGCCAGAGTACCAAGTACGATTCGCCCCC
CGGCAGCCAGAGCGTGCACGACATGTGGGTTGAAGTGGACGAGAAGTACCTCAAGCCGCTCTTCGGTGGCAACCCGCGGCTACTACGCAACGATTCGACC
ATG