Description :
From Genome Similarity Track
Location :
Scaffold_1081:452- 1925
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1081-fgenesh-gene-0.0Dicarboxylate/amino acid:cation

Sequence
1473 bases(100 bases per row)
CCGCGGGGCTTTGACAAGGCCGACGAGCCCATTGCCCCACCACCAGCCAACATGAACAGCAAGCTCTGGGGCTGGTACTTCGGCATCCCAGGCATCCTCG
CGGGCGCGATCATCGGCATCTTCATCGGCTACGGGATCCAGACCGGGAGCCCCTCCGAGGAGCTCGTGTCTTGGATCGGCGTGCCCGGCAGCCTCTTCAT
CCGCGCGATCAAGTGCATCGTGACGCCCGTGGTCTTCTGCAGCCTTGTGGTCGGCATGGCCGACATGCTCGCGGTCGGCAAGGCCTCGGCCATCGGCGGC
CGCACCGTGCTACTCTACCTGCTCACGACGGTCATCGCGTCCTGCGAGGGCCTGCTCTTCGTCGCGATCTTTCGGCCGTACTTTGGCAACAAGGCCCAGA
AGCTCGACGAGGCCACGGTCGCCGAGCTCACGTTCCAGTGCGACGAGCCCGGGTTCTATCTGAGCCGCCAGGTGAATGGGACTGTGAGCTGCGCGTATGA
CGCAGCATACAACACGACCTCGACGTTCTCACTGAACTCCCGGTTCATCACGAAGGACATCAATGGCTTCTTCGCGACCAGAACGGCCGACGCGGCCAAG
CGCTCGCTCTCCGACGCGCTCCAGGACCAGCTCGACGCGCTCGTGCCGAGCAACATCACCCAGGCGTTCGCCGACTCGACGTTGCTGAGTATTATCACGT
TTGCGATCGCGTTCGGAGTCGCAGTCTCGGCGCTGCCGGCCCACGCGCAGGTCGTTGGCGCGTTTTTCCGGGAGCTCAACATGGTGTTCATGCTCATGAT
CTCGTGGGTCATCAAGTGCACGCCGCTCGCGATCACCTCGCTGCTGGCGTCCAGCATCGCGACCCAGGACGACATGTCTGTACTTGTCCACGGCGTCGGG
CTCTACGTGCTCTGCGACCTACTCACGTTCTTCGTGCACGTCTACGTCTTCTATCCGATCCTGCTGCGGCTCTTCGTCAGGGCCAACCCGTTCAAGTGGC
TCTTCAGGATGGCGCGCGCCCAGGTGTTTGCGTTCGGGAGCTCGTCGTCCATGGCCACGCTGCCAGTCGTCATGGAGTGCGTCGAGGCCACCAAGGAGGT
CAGTCAGACTCTGTCGCGCTTCGTGCTCTCACTGGGCGCAACCATCGGCATGGACGGCGCGGCGCTGGGCTATCCCGTGGCCATCGTGTTCATGGCCGAG
GCCGAGGGTCTGGGCCACTTGATCGGTGGCGTCGAGTACTTCCTCATCGTGCTGGTCTCGACCATCGGCGCGATCGGCGCCGGGCCCGTGCCATCCTTCG
GCAGCGTGGTCACCATCACGATCTGGACGAGCGTGTTCCCAAGCGTGCCGCTGCCGTCGACGTACGCGTTCGTGCTGGCCACCGACTGGTTCATCGACCG
GTTCCAGACGGCCGTCAACGTCACGTGCGACACGATCGTGTGCCGCATCGTCGCGGAGCTCGTAGGCGAGACC