Description :
From Genome Similarity Track
Location :
Scaffold_1384:4519- 8681
Transcript NameFunction/comments
Phypl_g13273hypothetical protein

Sequence
4162 bases(100 bases per row)
AAATGTGGTGTCCGACCGACCATTTCAGATGATGTCAATGGACTTTGTTATTCCGCTTCCAAGAACTCAGCGAGGTAACACAGCTTTGCTTCTCTTTCAA
GACCACTTCACTGGATATGTGATCGCTAAGGCGATGAGCGACACTGGAGCACTGGAAGTAGCTAAAACGTTCGAAGAATCTGTCTTCCGACGGTTTGGAG
CACCATCGCTAATCCGACACGATCGAGACCCACGATTCATGAGTGAAGTCTTCCAAGCATTCGCTGAGTTGATGCAATCAAGATCCAGAGCTACGCTGAG
TTATCGGCCTCAAGCAAATGGACAACAGGAACGTTCGGTTAAAACAATGATCCAGACAGTCCGAGTTTATGTGGAGGATCCTCTGCAGGCTGATTGGGAT
GATATCGCTGAGAAGATGGTATATGCTATCAACAACTCACGAGGCACAACTCGGTGGGAGACTCCGTTTTATCTCGTACACGACTGGGACTCGCAGTCCA
CCCTGACGGCAATGACGTCGATTATTAAGAATGATCCTGCCAACTTAGCGGAGGCCACGCAATGGCGCTGAAAAGCAAATCGTCAACGAGAAATCGCTCT
CCAACTAGCGAAGGAATACCAGCTAACGGAGAAAGCTCGGCGGGCGAGAGAGCACAACGCTAAACTCAGCAAGAGAGAACAAAGAGCTATTCCAAGCGCG
AGGGACTCGGCGGAAGATACAGAGAACTCAGCGGAAGATGCGATGGACTcagctggagacgaagatgaagcgaCAGCCAACTCAGCTGGACTACAACAAT
TGTTGTTCAAAGCAGGAGACCAAGTGTGGCTGTTCGTGGAGCGGGTGAAACCtggcttgaagaagaaactaGCCCACCGATGGCACGGTCCATTCcgggt
gaagaagaaggttgAAGAATTTGCGTACGAACTCGTACTACCCGACAAGAGTGGTTACCGGTTCTATCCTGTGGTGCATGTGTCTCGGCTGAAAGCAGTA
GCCGATCCGGAAACGAGACCAACGGCGACGTTGGTAGACGAGCTGAGCGAAGCACAACGtttcgacttcgacgaggaaTTACTTCCTGAAGACAGCTGGG
AAGTCAGCGAGGATGCAGACAAATatgaagttgaagctatATTGGATGATAAGATGCCGCTCTCGACGAGTACAGATCGGACCCGAAGACTTTTCAAGGT
GAAGTGGATTGGCTATGACGAACCAACATGGGAACCGCTAGCAAATCTCTCCTATGGAGGCCTGTTGTTTGATTACTTGCGACAGAAGAGACGAGAAAAT
CGTCTACAAATGGTGCAGAGACTTAATAACCACAGCACCGCACGTTGACCGACACCAAGTGAAGAGGTACAGGCTTGGTGGATCGTGAAAATTACTGAAC
CCACTTACATGAAATTATATATGAAAtgaactcagctgagtcTTAGGAGCTACGAACGGGTAAAACTACTCAGCTGGGAGAATGGCCGGAAGAGAGCAGT
CAGAACTCAGCGTCGTCCAGAGCGTTCTCGAAGATACTGAGTCCCGCGCGGTTGGCAGGAGTCAGCGCGTGAGGAGAACAACGCGGTGGACTCGGCTCGG
CTTCGTCGATGTCTTCGGAGAGAGAAGCCGCGACATGCTCGTGGTCGAACTCGGCTAGAGCAAACACTGGGAACTCGGGATGAAGTGGGAGGAAGCACTG
GTTGTATGGGTGCAACCTAGGCTGACGAAGCCACCAAGCACGCCAAGGCTCCTCACGATCGATATCAGCGACAGTCGATGACCAGTCAGCTGACTCCGGG
GACCAGGGAAGATTGGCAGGTGGAGCAAACGGGTACGGCGGGTCGAAGTAGAGCTCCGAGTCCAGGATAGGGGCTGGACCCGCCGAGTCactcgacgaag
cagcttcgtacAACACACGATACATCTTCTCCAACAAAGCGCGCAAAACGTCACCTCGACGTTTTCGTTCCCGACTGTAATTCAACCACAAGTTGAGTAT
CAATTCGAGCTCGGCTGCAGTAAGATCCGGATGCAGAGTGGGATGCAAGCCGAACACCACACTGGAATCGACAATCCAGTGCATACGTTCCCACAGTGCA
ATGAAAATCTTCAACCAGTCGGGATGCTCACCTCGACATTTGAGCATGCACTCAGCGATGATCTCCACCAGCTGAGTTGATTTAGAAGAAAGACCACGAG
AACGGACTCGATCCAAGACATCGTCGGACATGAAGAAAGGTCCCTTGGGAAACTTGGCCCTCAACTGTTGACAAGGATGCTGGGGGAGAGAAGACGTCGG
CAAATGCAGCAATACCTTCCATCGACGACGGTGTCGGTCGTACGTAGCTTTTCCCATCCACATTCTCCATCTGAACGAGCACGATACACGACTTGAGGAT
CCTGTCCCAACATCGCCGAGCTCCGAAATGAAAAAACGGCGGATTGCGCCGCATCTTCATCTGAGGAAACACTCGAGAGTCACGAGtggcagcttgagca
gctcgacgtctcAGCTGAGCGATTGACAAAAGCCAGCACGTCTGGAAGCTGCCCCGTGATTGTTGTCGAACCCGCTGAGTTTGAACTCGGCGGCGGAGCC
ATCGCGGAACTAAGGACTTGTGCAGAAGTAGCCGCAGAAGAGGGCGCGGAACTCAGCTGACCCTTTGACTTGGCTGATTTTCCCTCCTTAGTTTACTTTG
GCGTCACCACGGTCTTACGAGCCGTAGGCCTCTTCACTACAGACTTCTTGGCTGTAGCAACAGCTCCATGTCTGCCCGCTGATGAACCAGCCGACGTCGA
GGAGACAACCGACGACTTCGCATTACTTCGAGGTTTCTTGACAAGAAATCGAGGAGATGGCGGGTGTGGCCGCTTAGCCTTTGCAACAGAAGAAAGAACC
GGTGAAACCCCAGAAGAAGGAGTCGCCGCTGAAGTACTCGGCGGAACTGCAGGATTAGCGACTGGAGTACTCAGCGGGACAGAAGGAGAACTTGGCGGAA
CCAACGGCTGAGTAactggaggagctggaaccTCACCCTTCTCCTCTTCACTCTCTTCACTCGACAAGAATAACTCCTGGAGGAGTTTGCTCTTCTGAGC
ATCAGTAAGAGTCCGTTTCCGCCGAGAAGACAGAGGAATATTCGCTTCCAAGTCGGATGAATCCTCCGGTGGACTCAGCTCAATGGTAGAAGAAGCTGAG
TTGTGCTGCTGGGAAGACTTCGCGTCAATGACTTGGGAGGATCCACTAGTCGAACCCAACACATCGAAATCCGACGCCTCCAAGTTATCAAGCTGGACCC
GACCGATAGCGCTGGCATCCTTGGAAGGAGCCCGTGAAGAACGGCGAGACGGAGAGGGAGTTGGTTTCTTCGACTTAaccttcttcgtcttccgaACGCT
TGATACCTTGGTAGTAGCGCCAGGCGCAGCGATCGGCTGAGTCGAGTGCGCCACACTAACCGCCACGCTGGACTGAGCTAGGGACAGTGACGAAGATCGC
TGAGTAGTGAGAGGAAGCTGAGTCGACTGAGCAGAGTGAGCTGAACTCAGCAAAGAtaacgcagcagcagcagattcaGCTGCCAACTGAGGAACGGAAC
GCTCCAAAGACGACGAGACGCCTGAACGAGTCAAGTCTGGAACAGCAGAGAGTTGCACCGACGGACTTGTCGTGGGGACAAGACCATCTCTGCGGTACCG
GCTTtctggaactcggcgggaCGTAGCTGGACAGGCGGCCGCTGAGTTGGAACTGGTTGTCGTTGGAATGGCCATCGAGCTGGTGATCGGGGGAGTGGAA
GTCACCGGCCGCTGAGTAACAGGAGGCGAGTACGAGTTGATACTGAGAGTAATTTCCCGAGCATCGCCAGGCTTGAACAGAGCCAGCTCCGGCCAACGCG
ACTCCAATAACCGACACAACTGAGTGTTCAGGTGAAGATCACTCGGGGAAAGCCCAGGGGCATCCACACCAGAAGCAGCGGCGATGGCCAAAGCAGGATC
AGAAACAGTAATCCTCCCTGAATGGCGGAGGATATTCTTCTGCTGAAGAATAGTCCGTCGCTGGGCTTCAATAGTCTCCTGCGCTAGGCGCAGAGATCGA
GTCGGACCACCGCTTGCCACAAtacgagctgcttcttggatCATGGAGAAGTACGAAGCCAT