Description :
From Genome Similarity Track
Location :
Scaffold_2:451877- 461207
Transcript NameFunction/comments
Physo_108180PREDICTED: similar to NADPH-dependent FMN and FAD containing oxidoreductase
Physo_155311hypothetical protein
Physo_155312hypothetical protein
Physo_127518hypothetical protein

Sequence
9330 bases(100 bases per row)
TTGCAATCGTGTCTTCGGCCAATCAGAGACTGAAAAGCAACGATGGCGACACCTTCGTCGTCGAGGCCGATGCCGCGGCTGCTGGTGCTGTACGGCAGCG
AGACGGGCACGGCGCAGGACGTGGCCGAGTTCGTACAGCAGCGCGCGTTCAACCGGCAGCTGCTGGACACGCAGGTGGCGGCCATGGACGCGTTCCCGGT
GGCACAGCTGCTGCCGCAGTGCTCGACCGTCGTGTTCGTCGTGTCCACGACGGGCGACGGCGAGGCGCCCGAGAACATGCGCAGCGCGTGGCGCAGTCTG
CTGCGCAAGACGCTGGGGCCGCAGTGGCTGGCGGGCGTGCGCGTCGCCGTCTTCGGGCTGGGCGACTCCAGCTACGCCAAGTACAACGCGGTGGCGCGCC
GCCTGCAGGCGCGTCTGCTGCAACTGGGCGCCTCGGAGCTCATCGACCGGGGCCTGGGCGACGACCAGCACGCCTACTGCTACTTTGGCGCGCTGAACCC
GTGGCTGGAGAAGCTCTGGGCGGCTGTGCTACAGCTGCACCCTCTGCCGGAGGGCGTCGCCATCGACGACTCGCCGAAACCGATCGAGCCTCGCTACTCC
GTGGTCGTGCACGGTGCGGGGGATAGCGAGGCGGAGGCTGCGAGGAAGCTGACGCCACGAACGGACGAGTCGAACTTCTACGCGCCACCACGCACGGCGG
TGGGGGTCGAGAAGGGCATCTACTTGGCTCCTGTCGTTGTGAACAAGAGAATTACGGCCGAGGACTGGGAGCAGGATGTCAGGCACTTGGAGTTTGATAT
CAGCAGTGGTGGTGGTGGTGGATCGAGTGTGGGTGGAGCAGCGGACGCTCCGTTCAGGGCCGGGGATATCACCGTTGTGTACCCTGAGAACGTGGCGGGC
GTGGACGACATGCTCAAGTACGTTAAGATGGACGGAGACACTGTCATCTCGATCAAGGCAGCAGACGGAGCGAAGCAGTTCGACCTGCCGTCTCCGGTTA
CCGTTCGTGATGTATTTGCAAAGTATCTGGCCATCCTGGAAATCCCGCGCCGGAGCTTCTTTGAGAGGCTCTCGCTGTTTGCAGCGAATGAAGAGGAGGT
AAGGTGTGTACGTGCGAGTTGAGCTTTGGCAACAGCGCTGACCTCTATATACGTTTTGGTATGGGACAGAAAGAAAAGCTCGAGGAGTTGGCCTCGGCCG
AGGGTGTCGATCTCTTGTATGACTACTGCATTCGTGAAAAGAAGACGTACGCCGAAGTGCTCACCGACTTCCCGAGCGTGACGGTGCCGTTGACGATCCT
GCTGCAGCTCATTCCTCGCCAGCAGCCTCGCTCATACTCCATCTCTTCGTCGGCTCTGCTTCACCCTGGTCGCGTACGTGGTCGTTCTCTCGACAGTATC
ATTGTCTTTGCCTGATGATGCTTATTCTGACGCTGGAGTTGTATCGTGCGACAGGTGCACCTGACAGTGGCCATCGTGGACTTCTTGACACCGTACAAGC
GCCGCCGCAACGGCATTTGCTCGTCGTTTTTCACCTCGCTCGATCCGTCGAAGGAGCAGAAGCGAGTGCCCATGTGGATCAAGAAGGGTCTGTTTGAGCC
GCCGAGCCTAGATCGTGACGTGCTGCTCATTGGACCAGGAACCGGGCTCGCCAGCATGCGGGCAATGGTGCAAGAGCGACAGTTCCTGCGTAAGCAGAGT
GAGGGCAACGCACCAGGAACAACATACCTCTACTTTGGTTGTCGCCATGAAAGCAAGGTACGGATGCGATAGATGTCGTTGGCAGGTATGGTGACGAATA
TTAAGGGTCGGCTGGTTCTGCTGCTCAGGATTTCCTGTACGGGGACGAGCTTCGACGACTGGTGACTTCAGGCGATCTCACGGAGCTGCACACTGCGTTC
TCGCGTGACCAGGTACTAGCTGCTCGTGCCTCACAGCTCCAACAATCTTGGTTCACGAAACCTCACACACTCGTGTCATGCTTGCAGGACCACAAGATCT
ACGTGCAGACGCGTCTGGCTGAAAACAAGGAGGCCATCTTCGACTTCGTCATGAACGGCGAGGGCTGCATCTACATCGCCGGGTCCGCCAAGCGCATGCC
CAACGACGTCTACGAAGTGCTCCGTGACATCCTTCGGTCTGTAGGCAAACTCCCGCTACCGACTGCAGAGAAGGTGATGAAGGCGTTGGCCCGCAAGAAA
CGCTACGTCGTCGAATCTTGGTCGTAGGAACCTTCACAGCCAGCAGCTTGTACAGAGCAAGGTTAGACCAACACGATTTCCACGGACCCAAAGTCTCCAT
CACCCCCCCCCCCATTTGATTCGCTAAAACCATTGCAAATCTCGAGGCTATGGACACAACGCAGGTGCCGGAGCAGGAGCAGGAGCAAGAGCGGCATGTG
CGGACGTTCGTGAAGCTCGCGAATCTGACGCAGACGTCGCAGCTGCACGAGTGGGACCTCAAGTCTCTGCAGTGCGCGCGGGAGTGGGCCCGTGCAGCCG
AAGATGCCGTGGCTGGCGACGACTCCCCACTGGACATTGAGATGCGCATCCGTCAGTGGTTCCCAGTCGCCACACTGCCCACGCTGCCGTTGGATGGAGT
TCTGACGGCCGACGCATTGCGCCATGCGGGAGTTCACTTGCTGCGGTCGATTCTGCAGAGTCCGTTCTTGGCGTCGCATCCGACGCGGTCAGAGCTGCTG
GTCGAAGTGCTCCAGGAGCTTCAAAGTAGACGCCAACATGCCAATGAAGTGGAAGAACATGCGTCCAATAGGTACTGGCTGGATTGAGTGGGTGAACGTA
GTTGATGGGACTAATGCTGTTCTTTGTCGTTCGCAGTGGTCTGCTGGTGAAACGCGTCACTGGAGCCCCACGCACAGAGGCTATGCTGGCGATTGCTGGG
CGACTGAGCGGCAGGTGCAAGCGCATTCGCGTTTACGGTATAATTGGATAAATACTGCTGCTTCGCGTGTAGCTTGTATGACTGACTTGTTTTCTCGAAA
TGGTAGTGCTTTCGGGCTCGGTGTTGATTCCCCCACTCAAGAGCTATGCGCTGTCGCCTCGGGTCTTGCAGCTAAAGGCGATGGCCAAAACATTGCAGCG
AAACGCAGTGGACGCCCGCGCAGCAGCTAACCCCGAAACATACTGTGGATTCCTCCATGACCTTCGAGCCTGCTTTGAAGAACCCGAAAGCAAAGACGTC
CGGGTAAGCAGGTGAATTTACAGTAGATCAACTGCCATGGTGTTACTGACTATGCTTCTGTCTGCAGGAAGTTGTGGTCCTGATGCTAGTGATGTGCGAG
TGGCCCAAGGAGGAACCCCCGCAGCTTCGAGGGATGATGGAGGATCTCGTTAAGGTTGCGTGCGATTGGGTTAGATGCAAACCTATTCGGTTCTGGACCT
TCGAGCCGTGGCTGGCAGCCATGCTGGCTAATAGGTCAGATGCCCTGGCAAGCGCGTACGTATCGGAGCTGTTCAAGACGGGACTTCTGCAGCCTTGTAC
GATTCTCAACCGTATCCAACCGCTTCGTTATCGTAAGGCGCGTACTAACTGTCGATGCATGGACTTGTTGCAGGGGAGCGCGAGTTTGCAGTCCGAGTTG
CGACGCTATCCTTACAAGGCGAGAGCGTGGAGATTTTTCTGCAGGAAGCCCTGGCGAAGCTGGATCCACAATTGCAGGAGATCTACTTTCGCATAAATTA
AAGCCCCAAGGTTCACTGCCTGCAGTGATTTACTTGCGTTTACTTCACTGCGTTTGGTGTTGCTGCAGCCGACGAAGCATCTCGACGATGGCATGGCGGT
TGCTTCGCAGTGCGAGGTCTATTGCTGTGGGGTATGGCGCTTCCAGGAGTGGAAGAGCTGCGTCAGCACCACCGTCACCAATCAGTGCGGCGCAGCAGTC
GGCGAATCCTTCCTCCCCTCCGATCAACAAGGCGGTGTATCCGAAGCGGTTGCGTTGATTGACCAGAGACCAGGTCCATTCCTTCTCGAGGTGAGCAGAC
TGGTGAAGATGCCTCAGGATGATCTTCAGCGAGGTTAGCGCGTTAGACGCCGTGGCAAGATGCAGAACCGAGTTCCCATCGGCATCAGCCACGAGGACGC
CCGCCCCCTGTCTAATGACACCGAGGTTAGTTGCCGTGAGTCGTAGGACGGGAGCAAAGTGCACGAAAGCTCACCGAAGGAGGAAATCAACAGCATCGTG
CGCATCCCATGCAGACGCATGCTGAAGAGCTGTGCGGCCGGAGTGAGGATGACGTTCGTCCAGCAGTGTCGGGTTGTCGGTGAACAGTGTGCTTAGAGCA
GCGACGTCGTTATCCGCTGCAGCATGCATCCACGAGTCCAACAGCTCCATGACGACAGAAATGGACAAGTAAATTAAGGTTAAGTGCTCTCTCTCTTCTG
TACAAGCTCAGACTAGACCGGGGCCGGGCATGGGGCATAAGGCTTCATCAGTCTGTGGTGAATCCATACACCTCCGTCTCCAGCACCGCGTACAGCACTG
CCTTCAATTCATTACGCACGACGTGAAGTGGCAGATCCAAGCGGTTGAAGCACGCGTGGCTGTGGATGAAGCCATCGCCCACTAGCGACACTCCTTTCAA
TGTGAACGGGCAGAGGCGGCCGTCATAGCTCATCAACGCCCCAAATCCACCCAGCGGTACACGCGATGATCCCGTCGAGAACTGAAGCAGGCGGCGTCGA
TACTCGTTGGGCATTTCGCGTACAAGTTCCCAGAACCACTTGAGCGCTCGATGGTTGTGCAGGTCTTCCGAGTACTTGGTGTTGCGCTCCCAGTCATCAA
CGTCGATCTCATCGGAGCCACATAGAAGGAAGTTGAACTCTTCAGGATCGAACAGCAAGAGCAGATCTCGTGGAATAATTTCGTACAGGCCACGAAGAAA
CGCCTGTAGTTGCGGCCCCACACTCTCCACCATCAAGTACTGCCACTTCCGCTCGACGTAGTCGCGTTTATTGCTATCCGTGACGGGGATGGCATCACCC
CCTGGCACCAGTTCGATATCACGGTAACAGTCCCCGTCCTTGACAGTCACAGCGAAATCGAGCCCAAGCGCGTCTGCGTTCTCGTTTTCAAGTAGCCATC
GCAGGTTCTCGTATACTTCGGGGTCGAAGTCTTCCAAGTCTGAAAAGGTGAGTGGGTAGCCCAGCATCAGCTTCAGCAGAGGAGGCGCCAGGTGGAAACA
CATCATCGAGCCTTCCAATAGTGCGCGACCCAGCAGCCGACCGACCGCATAGAGATGTAGTAGCTGATCTGGCAAGAGGTTCGCATTTGAGCACGGACTC
AGGTAATACGTTTGCTCGCTCTTGTTGGTGCAGTTGAACAACCCACGGGAAGGGTCCACGAGCATTTCGTTCAGCAGCACGAACCACTCACGATGGAGTC
CTCCAGCATCAACACCGCTCTCATCGAGGAAGTTGATGCGCAGTACAGAGTGCACATTCTTGCGTGGGATAATTGCGAGCGACTCCATCGAGTCTTCGAA
GACGTTAGCCCGCTCCACGTTTAAGCGCAAATGCTCCCGCTCAGCCGGGACTAAAAGCGCAGACGTTGCGGTGACGAAATGCGCGTACTTTGACGGGAAA
TCTCTGGCAGCGAGTGCCATCGTCTCAGGCAGAGGCGGCGACGCTGGTGGTCTTGACGTCTCGCCCTGTGTGTTGATCCGTTCGGCGTCAACACCGAATT
CACTGTCGAGGGGGAGCTTCGAGGCATCCATCAATTTATCAGACGCCGCAGCGAGCATAGCGCGCCGTGCCTGGGTGTCCCGTACCAAGCTCGCAATGCA
TTCTTCAACCGATCCCAGTAAAGACTGTGCTTGCTCTCGGCCAGCTGCATTCTCCGTAGTAACATGTTCTTGCTCTGGTTCTGGTTCTGGGATGTCTGAA
CTAGCAGAGGACTCGGCTTCCCCATGCATCAAGGTGTCCGCTGCACGCTCGACCGCCGGGACTGACGGTGGAGATAAGGATCTAGACGATGCCTCTTCGC
CTAAAGCAGCATTAGCCTGCTCTTCCGACACAGAATTCTCATCCTCTGCTGACGTTCGAGCCACTGTCAATTCCACAGCTTCCGTGGCCAAAAACTTGAC
CACAAAACCTGTAAACTGAGTATCACCCCATCGGCCGTCGCGAAACCAATACGCTCGTCCTTCGACGTCCACTTTCCTCGTCCACTCCTTCCTCCGTTGA
GCACGCGCATGACGACGACTAGTCTGCACCGAGTGTGTCGCCGTGACCAGCTCCACCCTGCTCTCGCGCTTGAACAGTGGTAACAGCGACAGCCGCGTGG
ACAACCGCTTCTTGCCTGCCGTGTCTCCACTACCTCCGTCTTGCTGCTCGCCGCTGACGACGACCGCCTCCCCGCACACGGTGCAGAACTTGAAGCGCTT
AAAGTTCTCGAAGCCGCAGACCGCACAAACGTTGAACCCCTCCTCTGCGTCTCTCAGCGCTGCGTCCAGCCGACGGTCTTCAGAGCTGCGTGGTGCAGTA
CAATAGGCTACAACGTCAGTCTTCTCTCTACCACGACAAATGCACCGACCGATTCGAGGGAGAAAGTTGTGACGCACTTGAGCAGCGGGGCGTGCAGCTC
GAGGGACCGCTGGCGCCGCATGTAGGCGCGTCTCGCCAGCATGGACAGACAGAAGAAGAGCAGCGCTACGATGGCGAGCACCGCGAGGAAGCCCAGCACG
GCCTCCATGGGCGCTTGCGGTCGAATCCGAGAGTGCAAGGTCCACTTGGCGTCCATCTGTCGAGCAACAGCTACCGTCATTCTGATTCGCTCGCCGCAGA
AGTATTTGCCATAGATAGCGGTTGCATATAAGTAGAAAGGTTAACAGGAAGTGGAGCGTATACTTTTGGGGTCGTCAAATGGCGGTACAGCTGGATGAGT
GTGCAAAGCCTGAACTGTACACCGAAAATAATGCTCGCGCTCCGATTACCCGACGCCGCCGCGCTGGTCATCAAGCACTTGCACCTCAACCCGCAGCGGC
GTCTTCATTACTTTCATGCTCGTTTCAAGAGGTTGTCAGTCCGTCGTGAAGCCGTACACTTCCGTGTTCAGCATGGCGTACAGCACCGCCTTCAGCTCGT
CTCGCACCACATGCAGCGGCAGGTCCAGCCGATTGAAGCACGCGTGGCTGTGGATGAAGCCGTCGCCAACCAGCGGCACGGCATTGAGCGTGAACGGGCA
CAAGCGACCATCGTAGCTCGTCAACGCGCTGAAGCCGCCCAGCGGCACGCGCGACGAGCCCGTGGCGAACTGCAGCAGGCGGCGTCGGTACTCGTCCGGC
ATCTCGCGCACCAGCTCCCAGAACCATTTGAGCGACCGGTGGTGGTACAGCACTTTCGAGTGTTTGGTGTTGCGCTCCCAGTCGTCCACGTCGATCTCGT
TGGAGCCACACAGCAGGAAATCGAACTCCTCCGGGTCGAAAAGCAGCAGCAACTCGCGAGGAACGACCTCGTACAGACCTTGCAGGAAAACCTGCAGTTG
CTGCTCCACACTCTCCACCATCAGGTACTTCCACTTGCGCTCCACGAACTCGCTCTTGTTGCTGTCGTTGACGGGAATTGCACTCCCGCCAGGCACCAGC
TCGACGTCGCGGTAGTGATCTCCATCCTTCACGGTAACAGTGAAATCAAGTCCCAGTGCGTCGGTGCCATCGTTGTCGAGAAGCCAGCGGAGGTTTGCAT
ACACTTCCGGATCGAAGTCTTCCAAATCCGCAAAGCTCAGGGGGTAACCTAGCATCAGCTTTAGCAGAGGTGGTGCCAGGTGGAAGCAGAGCATGGAACC
CTCGAGAAGCGCACGTCCAAGCAGGCGGCCGGCCGCGAACAAATGCAGCAGTTGCCTTGGCAGCGTTTCAGCATTTACACACGGGCTCAGGCAAAAGGTT
TGTTCGCTCTTGTTCGCGCAGACGAAAAGCCCGTGCGCCGGCTCCACTAGAGCCTCGTTGAGCATGACGAACCACTCACGTTGCAGTCCTCCAGCGTCGA
CCCCTTTTTCTTCAAGGAAATGAATGCGCAGTATTGAGTGAAGTTTGTGAAGCGGGATAATAGCAAGGGACTCCATCGAGTCAGCAAACATGTCGGCACG
ATTAACACTGAGGCGTAAATGCTCTCTTTCAGCAGGAACCAGCAGGGCGGAAGCACTCATCACAAAATGGGCGTACTTGGAGGGGAAATCTTTGCCAATG
AGTGTCATCGACTCGTTCAGAGATATCGAGGTGCTTCGTTTCAGAGCAGTCGGGGTTGGCCCGACCTGGACATCAAGAGACAGCTTCGAGGCATCCAATC
CAGCGTCTGTCGTCGACCTGAGCTTGCAATGCTTCGACGATACATTTTTCTCCAGCGCAGCAGTGCGTTCTTCAACAGATCCAACAGAACGGCGTGAACT
CGATCGGTTCCTGTCTCCATCAGTGTAGTGCAGTTCTTGGTCTGACACAGGGGACTTTAGACCACCAGTAATCGGAGCATCAATTGCATCGTTCGAGAGA
GAATCTACCCGAAAGTACGTGTCCCCAGAGAGCTCCACCGCCGCGGCTCCCTCCGTTTCTTCCTGTTTTCCGCTTGCAGGCTCAAACTCAGCAACAAAGG
CTGCTGCGAGGGTGTTATCAGCAGCGTACCGGCTGTCGCGAAACCAATACATTCGCCCTTCCACATCCAGTTTGCGCGTCCATTCCTTCCGGTTCCGCGC
TCGTAGGCAGCGACGAGTTGCTTGCCTCAAAGGCAGCGGCTTCGAAGGTGTCAATTGCACGTGTTTCTTTCGCCCGAACATGGGTAGAAGCGGTTTCTTG
TTCTTCTCCTCACCGGCACTTTCACCTTTTCCTCTTTGCTCCTCATCATCGGTCTTCTCCAGAATCGGTTCCCCACAAACCGTGCAAAATCGGAAGCGCT
TGAAATTCTCGAAAGCGCAGACTGTACACGTATTGTACCCTTCTTCAGCATCCCTTACGCACAGAGGTGACAACCATTAGCTCTACAGACCGTTCCAGAC
AACCTTCTTTAACGGAGAGCAACCAACCTTAGCGCTGCATCCAAGCGTTTATCCTCCGAGCTGAATTAAAGCACGAACAACCAATCCCGTCACACGACAG
CCATTAGAAGATGCAAGGGTGCTTGACATGTTCGGGCGACGGCGAGCTCACTCGGTCACCCGCTACCGCCAATTTCAACGTAGTACGCACTCGATCAGCG
GCGCGTTCAGCTCCGCCTCGTGCTCGAACCGCTTGAACGAACGCCGCGCCAGCCAGCCGAAGAACAGCACGAAAACCAGCGCGACCGCAGACGCCACGGC
GATGGTCACCCCCGCAGACATCGCTTAGGT