Description :
From Genome Similarity Track
Location :
Scaffold_41:45185- 46371
Transcript NameFunction/comments
g12592.t1hypothetical protein

Sequence
1186 bases(100 bases per row)
ATGGCAGGGTTGCGATGAATGTAAGGCAAGTTGCTCGGGAGGGTCTTGATCTGCATGCGAATTCCTTGCTCCTCATCAATGGTCACTATGCGTGGTGCTG
GTGGGGTGCTGTCTGCCTCGGATCGCGCAGGTCCGTCGGTGAGCAACTTGGCTTCGACGCGCTTCGTGATCGCTGCCACTGACCGAACAGAGTGCACTGA
GCGAATCGACTTGCACTCAGACAACACACTGCTTGCCACACTCATAGCGTCGTCGTCGCCACCCTTGGCATCTGCACGGTCCCATCCCAGCCGAGATAGA
TCGTTCCCGTTGAGAGCGCCACCTCCATTTGCTAATTCCTCAAGACGCTGCTGTTCGCGTTCGCAGCGCTTTTCCTCAGCCTCCTCATAGTCTACGATAG
ACTGCACCTGTGCTAACTGCTGCTCTACTTGAGCAACACGCGCCTTGATCTCCACGTCGTCCATGAACTGATCAATATCCAGGTTATTTGCAAATTCAAT
GAGGTCGTTGGCTTCAGCGTCCTCGAGGCTATCAAGTTTCTCATCAGCTGTGGCCTTCGTCAACGCCCACATAGGGCGATTCAAGCTCTTCTTCTTCTTT
TCGACCGCAGGCCCCACATCAGCATCAAGGTCATCCTCGTCATCGTTGTTGCTGCGAACAGCCTCGCGCATCTTAGCTTCACGCTGCGAAAACCGCTCTC
GACGCATTTGAGCAGCTTCTTCATCTTCAGCGAGCTCGTCCTGCAATCGAGATCGCTCTTTCTGCAAGTCGTGAAGCCACTTCTTGTGCTTTGACAGAGC
TGTGTTCTTTTTGTCGCGTCGAATACCATGCTGCGAGACAAAAATCACGAGTCCACACTCAGAAAATGTACTAACTTGTAGTAGCATTAAACGCACTGCA
GGCTCGCTGAGAATTGGCACGTTCAGGCCGAGAGGCTCGCCGGGGTTACCCGCCAGAAACGCCGCCTTGCTGTTGTCGACCACATTGTTGTTAGTCTTGG
CCCCGTATCGGTTCTCCTTTGCCAACGCTACACCAGCAACAAAACTACATCGTCAGAGTCGCAGCTTTCACGTTCCTTTACGAATCAAGCCACTCACTGC
TCGAGACCCCGTTGAACGGACGATTGCAGAGCATGACGCCCTTATAGTTGCCGATGCTCACAGCCGACGTCGATACGCCCGTCATG