Description :
From Genome Similarity Track
Location :
scaffold_4:451834- 454056
Transcript NameFunction/comments
Plaha_PHALS_08587FOG: Transposon-encoded proteins with TYA%2C reverse transcriptase%2C integrase domains in various combinations

Sequence
2222 bases(100 bases per row)
CAGCTCAACGACTAACGGCCGTACGCCATATGAGCTCTGGTACAACCGCAAACCATCCATGGACTACATCAAAGTATTCGGATGTAGTgcctacgcacat
atcacaGAACAGTATCGTGATAAACCTGATGCGCGAGCACGCTTATGTATGTACCTCGGTCTCCCTGAGCACAAGAAAGGCTATCGCCTCATGGCCGTAA
ATACCCATGCCATTGTCTACAGCCGTGATGTAACTTTTAGAGAGGACGAATTCCCTCGTTTACAGACCTTGACAAACACTGAGCAATCATCACAGATGCA
ACAATCTAGTACTGTGCAAACGAATCTTCTTGCACCCCGACCTGcaacgacatcttctgcagcGCTGCCCGTACTGTTCCCACTCAGGGAGGCTATTAAA
CGCACACATTACACATTTTGTGGGGAGACGATATCTGATCCTCCTTCTTCTCCTACGACTAAGAAACCCCATCTCGACACCGTCGACATGAATGTAGCCC
TCAACTCTGAGGAAGACTTACAGGAGCAAAAGCAGCGCAGGTCATTACTGTACACATTACTAGCTATTCGGTATGTTACAGAGCCCACTACGTATCGAGG
TGCGATGAAATCCCCTCACGCTAATCAGTGGCAAAAAGCAGCCAAATCGGAATACAAGTCCCTCATGGATAATAAAACTTGGGTTTTGGTATCTCCTCCG
AAAGGACGGAAGATTTTAACCAGCCGATGGGTATTtgttgtcaaatacaccGGCACAGTGCGAAATTGACCGCTTCAAAGCGCGTCTGGTGATCAAAGGT
TTCCTTCAGGAACATGGCATTGACTACAACGAAATTTTCTCACCTGTTATCAGGATGGAAGTACTTAGACTCGTTCTCACGATCGCAGCCCTGCTCGATC
TAGAAATCCACCAAATGGATGTCAAGACGGCATTTCTTAACGGTTTTCTGGAGGAGGAGATCTACATGGCTGAACCGGAAGGTTTCAAAATCCCGGGTAA
GGAACACCTCGTGTGCAAACTCCTGAAGAGCCTGTACGGGTTGAAACAAGCTCCTCGTGTCTGGTACCAAACGTTGTCCGCCTTTCTTGAAGATCTTGGG
TTTACAAAGCTCATTAAGGATCGTTGTGTATTCGTACGCACTATTGACGGTGTCACCTGCTATATCGCGGTGTACGTTGATGACCTTTTGATCATTGCGC
CTACTCCAGCCCTTGTAAGTGAGCTAAAATCAGCCCTGAAAAAGAGATTCTCCATGATAGATTTAGGGGAGGTGAAGTACTTACTCGGCTGGTCCATTCA
ACGTGACCGTAAGAACCGAACGATATTTATCCACCAGCACAAGTACGCTACGAAGGTCCTTGACCGTTTCAGCGACTATATTCTGTACCCAATTGCAACA
CCAGCAGAACGGAACGTAAAACTCTCCGTAAGCAGCCAACGTAGCagtgaagaagagaaagatgCGATGAAAGAATTTCCGTATCGCGAAGCCGTTGGTA
GTATCATGTATCTCATGGTAGGCACACGACCTGACATGGCATTCTACATGCGTGAGGTCAACCAATTCCTAGCTAATCCGGAAATGGAGCACTGGAAGGC
AGTTGTCAGAGGTCTTAAGTACCTTTCAGGAACGAAGGACTATAGTCTTCTCCTTGGTGGATCACTTGACACCACACCAGACAATCTTGCCGACAGCTTG
ACCGCTTACAGCGACTCCGACTATGCCAACTGCCCCGACACGAGACGTTCTGTCGGTGGATATGTGACTATGTTAGCTAGCAGTCCAATTTCATGGCTTT
CGCGCAAACACCACACTGTGGTTATATCAACAACAGAGGCAGAATACATTGCCCTGTGCCACTGCATGCAAGAGATGATATTCCTCAAACTGCTCCTCCA
AGAGttaggttttgctacgaTGCAAGCTAACTCCATTTATGAGGATAACCAGAGCTGCATCAAAATCTGCTATAATCCGGAACTTCACAGACGAACAAAA
CATATACACGTACGCTATTGcttcgtacaagaaaaagttgAGCGGCACGAATTCTCCGTCGCCTATTGCAATACCAAAGAGATGGTGGCTGACATCTTTA
CAAAAGCTCTAGATAAGCATCAGTTCAGAGAACTAAGGACCAAGCTCAGGATGAAATCCCTGACTGCTTAACGGTCTTCCGTATAGTGTACGAGAATAAC
ACTAATGCATGAAGCATGCCTA