Description :
From Genome Similarity Track
Location :
Scaffold_22:451811- 452854
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G008436Protein of unknown function

Sequence
1043 bases(100 bases per row)
GAGACAAAGGGGTAGACGTTGTTACCTTCGAATGGACGCAACATTTCCTGTCGAAAGAAATCGAATGGACTCATTTGAGCTTCAAAGTCGTCGTCTCTGA
AAATAAAAAGAGAAATGAACGTCATAGAAGAAAACTCAATGACAACATCGTTAGACAACACATACGCATAGTAATAGGCAATGCAACATTGACAACCATA
CCGTTGGAAGGGATTGAAGAAGGCCCCAAAGACAGAATCATCGCTGTGCATGCGCATTACGGATGCATTTACGTCTATCAGCACAGTTCGCATCTCAAGA
ATGGCCTTGCAGCAATACCACAGCATACCCTCTTTTCGGATCCATTCGCTCGCGATTAAAGAAATCGCCAGCGGAAAACTCACCGCCGTGCTCGTCCTCA
GTGATTTCTTTTCGGTTCGAAATGAGCTCCTAGTGCGGCAACACAATTAGGCGCTCGTTAAATATGCAATCGCGATCGCTTTCACACGACTACATGTGAT
AGAAAAGCTTAATTGATGCAATCGCTTACTTTGCTCTGTCCTGGACACTGTCGAAAGATCTTTTTGATGATCTCGCACTTGCTGTCGCCGTTAATGGAGC
GGCACGATTGCGACAACGCTGTCGAATAGAAGCATCCTACACATTCAAAACGCACAACCAAACAAACACACAGCAACAGCATTAGCGCAATTGAATCAGA
TTCACGCACGTATTTTTTGCTTTTCCATCACGTAGTGCAAAACCAACTATGCCCATTATTGACAAGAACACATTGCACCGTTGAGGACAAGCGCGCGTTG
CGGCCACTCACTCCACCGCACGCAGCGTACAAACTCGCACAGCCTCATGGTCCTGCTAAGCAGTCCGCTAGAGTAGCTGCTGCGTGAGCGCACCTGGGTT
CTCCTCGCGATCGCGCTGGATCAGCTCCTGTTCTTCGTCGCTCAGAGTCGCCATCGCTCGTGTCTTCTCTCGTCTTCTACGTCGCGCTTTTTCCGCCAAA
TGATGAATGTGTGTGGGGTCACTCCACCAGAGCACAAAATTCC