Description :
From Genome Similarity Track
Location :
Scaffold_30:451547- 452655
Transcript NameFunction/comments
Phyra_7831860S ribosomal protein L27 putative

Sequence
1108 bases(100 bases per row)
AAGACAACAACAGCTTCATGGTTTGTTTCCTCGAAACGGAACGGAACTGGAATGGGCTGCATTTATGTTAATACCCCGATTCCCACCAGCCTCTAGACGC
AAACAACAGCTTGCACTTAGAAGCGGAGCTTCTTGAAGAAGAAGCTGACACCAGCAGCCTTCTTCTCCGACTTGCACGCGGCCTGGTTCAGGTAGCTGCG
CAATAAAAAAATAAGACAAAAATCAGCATCCATTACAGCGGACTGTGTGCAGTAACTGCTCCAAGGACGTACCGCTCCTCGAACACCTTCTTGATGGTCT
TGCGGGACTCGATGCGGGTCTCCGGGTTGGCCAGCACCTCTTCGTCCAGGACCTTCTTCAGGTCGATGTCGGCGACGTAACGGGTAGGCATGATGTGGTT
GTAGTTGACGTACTTGACGAACGGTTTCACCTTGGAGCGCTTCTTGAGCTTGTTCTTGCCCATGGAGCGCGTCACCTTGCGCGGGTAGCGGTCAATGCCG
GCAACTGGACAAAGATACATAAAGTCAGTCTTGGTCGCTCTCTTAATGGCGAAACCTGTAATTGATAATTCGCGTACCGATGGCGTGGCTGAACTTGCGG
TCGCCATGGCCCTCGTCGTAGGTCTTCACAACGATAGCCTTGCGGCCAGCGAAGCGGCCGTTAAGCAACACAACAACCTTTCCGTTCTTGACACTATAGA
GCAGTAGTAGCACACATGTGCGTCAGTTTTTCTGTCCTTTAACTCCCTGTTGGCTGTTTCCTGTGCTCTCCGCCCGCCCGCTTTCTCTCTCAAATCAGAT
CTGTCCACTGCTAGTGATCGCCCCGTCATCGTCCCAGGGGCTCTGTCCTCGCTGCTTTGTTAACGTCTCCGTGCACTCGAGAGAAGGAGAGCGGGCGAAG
GCTGCCAGTCTATCTGCCTGCCTGTGTCATTCACTTACATGCCCATGTTTGCTTTTCTTGGGAGTTTTGGTGCAGTTCCGTACTGCTGGCGGCTCGCATG
AAGCGAGCCCAAAAGCCAGGGCCAACCAATCGTGCGATCCCGTCGCTGATTGGCTCTTTCCCCCCGATCGCTCGGTTCGCTGCGGCCACCGGCGGTTCAC
TGAACCGC