Description :
From Genome Similarity Track
Location :
Scaffold_1:451526- 453213
Transcript NameFunction/comments
Phyin_T30-4PITG_00045Myosin-like protein

Sequence
1687 bases(100 bases per row)
AACCAGTCGATCCTAGTCAGTGGTGAAAGTGGCGCCGGTAAGACGGAAACCACCAAGTTCGTGATGAACTACCTGGCCACCATCTCGCAGCACAAGAACA
CCTCGGCCGACAGCAACGTCATGAAGCAGGTTTTGTCGTCCAATCCGATCCTCGAGTCTTTCGGCAACGCGCGTACGATCCGCAACGACAACAGTAGTCG
TTTCGGTAAGTTCATCAAGATGGAGTTCTCGTCCGAGGGGAGTCTCGTCGGAGCGTCGATCCAGACGTATTTGCTGGAAAAGGTGCGTCTCGCGTACCAG
GCCGAGTCGGAGCGTAACTACCACATTTTCTACGAAATCATCGCTGGAGCGACCGCCGAAGAGAAGAAGCGATGGAACCTTAAGGCGCCGACCAAGTTCC
ACTACTTGAACCAGAGTACTTGCGTAAAGCGTAAGGATGGGGTGAACGATGCCGAGCAGTTTGGTGTCCTGAAGAGCGCCATGCAGACGATGGGCTTTGA
CGACGATGACATGGAGAGCATTTTCGTGACGATCTCGGCGTTGCTGCATATCGGCAACTTGGAGTTCGATGAGACCCACCACGCTTCGGGTACAGAGGGG
TCTGAAATCTCCAACATGTGCGAAGATTCGATGAAGGTGGTACTGGATTTCCTGGAGGTCGACAAAGAAGGTCTAGAGCTGGCGATTTGCAACCGCAACA
TCCAGACCAAGGACGAGCATTACTCGATTGGTTTGCTGCCTGATGCCGCTGAGAACGCGCGTGACGCATTGGCTCGATTCCTGTATGGCAAGCTGTTCGA
CTGGCTTGTCAGTCGTATCAACGAGATCGTGGAGAACGAGGACCGTGACGTTCCGTTCATTGGTCTGTTAGATATCTTTGGCTTCGAGGACTTGGAGCAC
AACTCGTTCGAGCAGCTGTGTATTAACTTTGCGAATGAAACGCTGCAACAACATTTCAACCGCACTGTGCTGCGTATGGAGCAGGAGACATACGAGAGGG
AGGAGATTCAGTGGAGTTTCATCAACTTCCCCGACAATGGTCCGTGCATCGACCTGATTCAGGGCAAGCCGTTCGGTATCCTCCCTGCTCTTGATGAGGA
GTGTATTGTTCCGCAGGGTAACGACCAGAATTTCGCACGAAAGCTGTACCGTCAGCACGAGCTGAACCCGCACTTTAGTGCGACCAAGACGGAGATGGCT
AACCACCTCTTTGTCGTGCACCACTACGCTGGCGCTGTCACGTATGACACGTTTGGGTTCTGCGAGAAGAACAAGGACATTCTGTACCCGGAGATCACTG
CGATCATCAAGCGGTCGTCGAAGCCGTTCGTGCGTGGACTTTTGCAGGTCGCGCCTGAGAAGAAGACGCCGGCTAAGAAGACCAAGGGTCGAGCTTCCAG
TACTGCCGCGCGCGTGAGTCTGGGTCTACAGTTCCGTACCCAACTGAAGACGCTGCTGGAAACCATCAACGTCACCGACTGCCACTACGTGCGCTGCTTG
AAGCCCAACGACAAGGCCAAAGCCAACTTGTTGGTGCCCAAGCGTGTGTGTCTCCAATTGAAGGCAGGTGGTGTCCTGGAAGCTGTGCGTGTCAACCGTG
CTGGATACCCCGTCCGAATTGCTCACCAGCAGTTCATCAAACGTTACCGTCCACTCGCCAACGGCGAGTACTTGCAGCGTATCCCTG