Description :
From Genome Similarity Track
Location :
Scaffold_292:45145- 46828
Transcript NameFunction/comments
Aphin_H310_08576Cullin family protein, putative
Aphin_H310_08577peptidase putative

Sequence
1683 bases(100 bases per row)
TGGGGAGGAGGGTTGTAGGCTTGTTTCGCGGGCCACGCGGCGTAGTTTGTCGACTCGAGCCACCACGCGGGGTACCCCGGGACATGCATGTCGCCAGCCC
GGTCGCCTTCAATCACGTAGCCGTCGTTGAATTTGCCCACGAGCTTGAATGCAAAGGTCCACCACCGATCGACCATCGCTTGAGCAAACTCGTTGTTGCG
GCGTTCGATAAAGTCAAGGCGCGCCGACACGTCCGTGAGGTTGTGTACTTGAACGACGGTCTCGGCCTCGAGCGCAATCGCTTCGTCCTGAATCGCGTCC
AGCTCCTTTTTCACGTCGGCGTGGATGAGGTCGTACCGCAGCATGCTCCAGTTGTTGACAAACTGAAAGGCCCACCACGCGGCCTTTGGGTTGAATTCGT
GGCGGCGACCCACGAGATACGACGGTGGAATCGTGCGCTGGGCACACGAAAACGGCGTGTAGATCGACCCATGGGGGGCGCCCAGCGCGTACCAAGTCAC
ACCGCCAACGTCGTCTGGGAGGTTGCCGCGCGCTTGCAAGACAAAGCTATGGGTCGTTCGGTGCATCGACACCGATCGTTCCCACCCGCCTTGCACGCCT
TTGTTGGACCCGCCGTATCGCACTGGGTTGCCAAACGGACCCGCCGCCGTCTCCTTTGTCATGTCGTACGGCGTGCCTTCGTAATGGTCGCGCATCATGT
CCATCAGGCGCTTTGGCGTCACTTTCTCGTCCGGCGCGACAGAAAATGGATACGTTTCAACGGTGGGATGCTGGCCCAGCGTCGAGTCAAACTTTTTGGA
CGGCGCAAACACGTCGAAGATGCGCCAGATGCGACGTCCGCCGTACAGGGGCTTGGTCGGGCCTGGTTTCGCCCACGAATACGCCGCGGCAAAATCAAAC
GGACCCGACGCTGGGTCCCACCACCCCATGTCCTTTGCAAACGACTCGACATTGGACGACGCCATAAAGTTGTCTGGGTCGGCCAGGTTGAGCTGGCGGA
TGACAAACGAGTTGGCGACGACAGCAATGTGATCGTCAGGCACGCGTTGCGCTGCCCACACAGCGCTGCTGTTGTTCGGCCCCGTCAAGATGTGAAAAAT
CCAAGATTCGCCATACTTGTCTGAAATGCCCAGCGCTTCCGACGAGCTCCCGTAGTTGGCGCGTTGGTTCTTTCCATATTCACCGAAAAAGCCATGGGTC
TCGGCCAAGTCGCCCATGAGTTGGATGGCACACCGAGCGCTGTCGCAACGTTCGAGGGCAATCTTCGACAGCTCTTCAATGCCAAACAAGTTGTGACCGT
AATGCAGGGACTTGGGCCACCCCACGGTCTTTGCCGCGCAGGTGCTTTCAGCAATACTCAACTGGACGTCGTTCATCATGCCATAGTCGTGATCAAAGTA
GCCATGTGTGTACGGGACTTGAGGGATGTGGCCGATGATTTTCGACACGGGTTGATCGCCCACGGGCTCATACAACGGACCGCGATCCATTGTTACCAAG
CGAGGATATCCATTTCGCTGAAAGTTGTGCACATGACGCACGGACCCTTCCGAGTGATTCATGGCTGGTACGCGCACCATGCGTAAATCGGATGGGTTCA
AGCCAGCGTCGTTGGTGTGGGTCACCATGACTGATCCATCTGCCGTCGCTTTCTTGCCCACAGCAATCACCGTGCATCCTTCG