Description :
From Genome Similarity Track
Location :
scaffold_23:451428- 453876
Transcript NameFunction/comments
Plaha_PHALS_05928tkl protein kinase

Sequence
2448 bases(100 bases per row)
GTCGGCCTATATATGCAGCATGGCTGTGATGTAGGACGCGCTGGGGCGTAGCGATGGGTCGTATTGCAAACATGCACCTGCCAGCTCTCGCACCGCCGTG
GGACATTCTGATGTGAATGTAAACATGCTCATAAAACTAGTATTGTTGTTGTCGTTGGTACCGAGCACAGGAGTTGTTCTTCGCCGCTTTTCTTCCAACG
TGAGACTGCGAGAACTTTGTAGCGAACGATAGCTACTATAGCTGGGTAAGCTTTCTAAATGAGTAGTGCATCTTCGCACATTGTCCACGTCAGAAGTATC
TGTCGATATCACTGTTCCGTCAGCTGAAAGAAGAGTGCCGTTGTCTGTATCAAAGTTTCCGATGTGAGTGCGCATTTTCCATGAACTTCTGATCATCTCA
TCTGCAGTCTGGCATGTGTCAAGATGTGCCAGCAGCACACCAAACGCGTACATATCGGACGATGACCGAGATGGCCCACCAACTAATATTTCAGGGGCAA
AATATGCTTTTGAGGCTGTATCGCAACGGCGGAGATATGATTGGCAACTGTAACGAGATGATTCGTTCGTCGCTAGTGCTGCCTGCATAGGGTTCAGTTT
ACAGCCTTTACTTGGATCTACAAAGACGCTTTTCCCATTGAGTCCATCATACGTGACCATATGCTGATTGTGTAGGTACATGAGCCCACGAGCGATTTCA
GCAGCTGCTTTCATCTTAAAGTTCATCCAATTCAGTCTAGAGCCGGAACTTCGGAGATACGCTTCAAGAGTGCCGAGCGTCATGTATTCACAAACTGCAG
TCATTGCTTGTCGTTCGTCCCAAACAACTCCACATATCGAGAGTAATTGAGGGTGACGCATCCGTGATAGAACCGGCATCATGTCTAGAGCAGCTTCAAT
ATCATCATCACTGACTCGAAGTTTTGTCACAAGCACCAACTTTGTTTGGTACTCAGCCAGGGCAACCAACACTGGTCCAGGAGCTGACAATTCGTTCAGC
GTGACCACTTCACCCGCAGGGATTTCTTCAAAGGCAGCTTTGCGCAGTCCTCCTCCTTTAATGTCATACTCGTTTAACGAAGCTTCAAGATCTGAAGTTT
GGGCTGTGCCATTCACACCCATTCGTGCTCGAAGACCCCTCAGACTACTTTTGAGTTTGGTATCAACCGCCACAAGTGAATCGTGCTGTCCCTTTGCAGC
CTTTTGCTTCCATCTTCGCAAAAGCAAAACACCACCAAGTATGGCTACCACTATGAACACCACGAGTCCAAGAATAACACCCACCACATCTGAGCTGTCA
TCGCTTCCGCTAGCAGGAAAAGCAGTGCTTTTTTCCGTAGATTCTGATCCATCAATGCTACCAAGACTATCACCGTTAGTGTAGCAGACGCTCTTGCCAT
TCCATGATATAGTATCATAACCCGCAGAGCAGCTTCCACTGATTGTCAAATTGGCTTCGAAAACGGGTAGTTTTTGCAAATAAAGAAGTTGCGGCAGGGT
AACGTGAGCATTGACAATCATGTTGCCTTGTAGATAAAGAGCTGACAGATTGCGCATTTCATATATAATGGTTGGGATTTCAGACAGATCATTGTCGCAA
AGATTTCTATCGTGTACCGCTAAAGTAAGAATTATCATCAAGAATTTCATACAAAATAGACAGACGTACAATATGGACACCGAAGTGAAAGCATGGGAAC
CACGGGGATCAAACTGATTAAGGTGCGCCCGCTGAATGATACTTAATTAGTTACGTCAGTATGTCAAGCAGAGAAATCATGTGATAATAACCTTACAGTG
TATGAAGCGAGTCCGGGAAAATATTTGTCATCAAACCTCCAACATTAACGTCAGAAATTGCACTATTTGTCACATATGATAACATAAGTTGTTGTGAGAC
TAGTGCATGCATACGTCACACACTTACAGTTGCTGCAATGCTGTGCCACTCCGAAACGCACCGGGCAAAAAAGATAGCGGCACAGATATTTGGGAGCTCG
ATGTTGCACCAACAATAGACCTAAAAGCAGAGCGTCAGACAAGCTGCTACTCATCACTGAAAGCGGTTTAAGCGCACAATTCTTGCAGAGTCGACGGCAA
CTCTAATATGTCAATCTCCTGAAAAAGTGCGGTATCCGTCTTGTCGCTTTGGGGTTTAGCGACTGTCAACGTCCAGTGAGGCTGACTCCAGCTAGCAGGC
AACTCCACTAGACACTGCACTTGGCAGTCTCCAGAAGTCACATTCGTCTTGCATGACGGCATGTTTGACGCCGCGCAGCCTTGATAAAAGAAGCCAGCTT
CGCTACTTTCTTTGTTCCTATCCtccgctgttgacaaggCATAGACTACGCATAGCGAAGACCTGCAGACTCCATAGCAGTTGCTCGAAAGCGTGCTGTG
GTCCGGTGACATGCACACATCGGTAGCCACCGCAAGACCGCGAGTGCT