Description :
From Genome Similarity Track
Location :
Scaffold_733:4514- 5819
Sequence
1305 bases(100 bases per row)
ACAGGGGTATCCGGCACGAGGTTGACTAGGAACCTGGCACCTAGGATTGTGTGACCAGGCAGTGACCGTTGCCGAAGAAACATGTCGATTTCATCGCCAA
TTGTACGAAGCGAGCCAAAGCGGGACATGTAAGTGGTAGCAAGATGCCTTATTGCAGCCCATCCTTTCGTGTGCGTAAGGAAACAGGTGAATGGCGCAGA
GTTATGCTTACAATAAGTTGAGCACGGCTACATCTCTGCGCATAAAATGATCCCGCGGAGATGTCCTATTGACTTCAAGGAGGAATTCAAAAAAATTCTG
CATTTGATCTCAAGGATGGTTAATATCAGATTATTACGAATGAGACCGATGCAGCCAAGACGACAGTTAGCACCCTGAGCGGTATGCTGTGGGAGTGGCT
AGTTATGCCGCAAGGGTTGAAAACTTACCATCGACAGTCAACCGGGTGGTCGCTTATGTGATGCATCCACACCGTGCCTACGAGACCCATTTATTTGACG
AAAGGTTGGTTCATAGTAAGTCCGAGGAAGGTTTACGGAAAATTGAGTTCCACATACGTCATTTTGGAAGTTGTGTTGCAGACTCTGGAAGACTTTCAAA
TGTACGTCAGATTGCAAAAGTGCATCATAGGGGTCCCCAAGATACCTGTTCTGGGCTTCATCGTGGGAAAATGTATCAGAGAAGACCTATAAAAGAAAAA
GGCTATAAAATAATGACCAGCTCCACGACATGTAACGAGTTTACGTTAATTCATTGGGCTTGGTAATTACTTGCATAACTACAGCAAGAATTATGCAGAG
CGAACCAAACCAATGTTGGATCTCCTTGAAAAGGATAAATAATGGATTTAATCTAAGACTCAAGTGTATGCTTGATTCAGTGAAGATTCGATTGGAGAGC
TCCGCTTGGCATTGCCAGACGCGGATAAGCCCTTTAGAGTCGTCTGTGTTGCGAGTAATTTCGCCATCGGAGGTCCACCTATAAAAACAGATGACGACAG
CATTGACCGTGTTATCTTGTATCAGGCCCGGCTTTTAAAGACCACGGAGATGGATTACCCCGTACAAAGAGCTACGTTCTATAAAGTATGCTATTGTGAA
GTTTCGTGTGCACCTATTGGCAACGAACCTTTTGTGGCTTACACGGATCACGCATCATTGCGGACCGCGATAAACTCACCACATTTATTGCCTTTAATGT
TGTGGTGGCTCACATTCTTCTCAGAATTGTCATTTTCTAGTCAAACACAAGCCGGGGAAGTCGAATTTCTTGGCTGACGCGTTATCGCGCAGACCAGACT
ACAAG