Description :
From Genome Similarity Track
Location :
contig_32:451348- 453716
Transcript NameFunction/comments
g7368.t1XP_008912404.1 hypothetical protein PPTG_16585 [Phytophthora parasitica INRA-310
g7369.t1RAW32305.1 hypothetical protein PC110_g11358 [Phytophthora cactorum

Sequence
2368 bases(100 bases per row)
AGCACCCGCGAGTGGATGGAGACGCCTAGCGTGGTGCTGGACGAGGCGCGACTGCAACACAACATCGAGCGCATGCAGGCGTTGGCGACGTCGCACAGCG
TGAATCTCCGTCCCCACGCCAAGACGCACAAGACACGGGAGATCGCGGTGAAGCAATTGGCGGCAGGTGCAAGTGGCCTCACTGTCTCCAAACCGTCTGA
AGCGCTGCGGTTTTTGCGCGGGGAAGTTCTGGGCCTCAAGAGTTTGTTGTTGGCATACCCGGTCGTGCAGAGCAACAAGGTTCAGGAAGTGCTGAAGGCA
GCGCAGGAAGTCGGCGTGGAGTTTTTGCTGACGGTGGACAGCGCTGAGGGTGTTGATGCTGCGCAAAAGGCGTCGGAGGCTAGTGGCTGCAACTTGAAGC
TGCTGATTCACGTTGACGTTGGATATCACCGCGTGGGCATTGAGGAGGAGGACCCGCGACTGCTACAGCTTGCGCAGCGCATCGACAAGACGAGCACCCT
CGAGTTCTGCGGACTGCTGTCACACGCAGGTACGACGATCTTGCTACGGAGTGTTGGAGGAGGAGTGCGCTGACTGGTTTATTGTGCTTAGGCCATGCTT
ATCGCTGCAAGTCGGTAACGGAATGCTCGGAGGTTGCGGAGACAGAGAGGTCGATTATGGTTCGCATCAAGAGCATGCTGGAGCAGGTACGAACTCGGCG
GTATTGGGTGTTATTAGAGGTCTAACCGAGCTCTACTCGATGTTATATTAGAATGGAATCGCAGTCCCCGTCGTGTCGGTCGGAAGCACCTTGACGGAAT
TTGCTCGAAAGGACTTCACGGGCATCACGGAAGTTCGTCCGGGAAACTATGTGTTTCTTGATCGCACTCCTGTGCGCATGGGACTCTTCACCATGCAAGA
CGTCGCACTGACTGTTCTCGCCACGGTTGTGAGCTCAAACAAGTACAACTTCATCGTCGATGCAGGATCCAAGGTGTTGAGCTCGGATGGAGCTCGATCG
GCTGGTGATTTCGGCTCGACATGCTACGGCCTTGCCTTCTACGAAAAAGATTTCAACCGCGTTGTGAACGAGCCCACTCAGAACAAAACGCAGCTCGAGG
ATGGCAAGGAGCTGATCTGCTTCGAAGTGACCAGCCTGTCGGAAGAACACGGTTGGGTGAAGAAGATCGAGTGTATTCCTTCACCAGCCATCGGCCAACG
CCTTGTTATTGTGCCCAACCACGCCTGCGTGGTGTCGAATCTTACTGACAAGTTCTTCGTTCAGGGCGAACAGGCGAAGACCTGGAAGCTGCTGTCGCGT
GGCTGCACTCAGTGAAGTGCTCATTTTGCTATCGCCCACCAATGGCTCAGACATGACTTTAGCTTCATTTTAAAACCACTGCAGCTGAATGCTTTCGATA
AACTCGCGGCTGGCTTTGTCTTGGATCCGTCGCATCAACTCCTCTCTTGTTTTTGGCAGGGTGCTGGTGGCGCCACCGTCCTTGGCTCGGAAATTATCAA
GCATCTTGTTCGTGGCCACCTCAATCGCTTGCAGCTCTTGCTCTTGTGTAGCCATGTAGTGTTCGAACGCTTCAGTCTGCAGATGCGATTCACGCAGCGA
CTGCGCCCACTCCTCCTCGTACGCCAGCTTCACGAGATGCCTACGGAACGGAGATCGCAGGATCTTGGCGAGCATAGCTCTGAACGACACGTTCTCCACA
TCTAAAGCTTGCTCCGCAACATGCTCGAGGTTCCGATAAAAGGAGGAACTCTCAGTTTTGGCGGTAGGCGACGGTGAATGGTACATCCATGTCGTGAGAG
CATACCTCGGCTTGACCGACGGCATCACGCGGTGCAGCATTTGCTGCGACGAAAAGAGCACCATCTCGCCGAATCGCGGTTGCACCACGATACGCGTTTT
CGGGAACGGGTAAAGCACGATTTCACCTCCATCTCCGTGACCCCACTCCTCATTCAAGTAAAGCACCGCTGTAACGCACTTGCCGTCGTCTCCATAGGTA
TCAAAGTGCATCGGGAAGCAGGCTCCTCGTCCAGCATTGTGCTGCACCTTGACCATGTGTCCTGCAAGCCCCACCCATGCCGGCATCGCTTGAAGCAGTG
GACCAAACACCACTTGCTGCTCGAAAAAGTCTCTCAGGAACGGCACAGACGTTTGATCTCGAACCGCATCCAGCGCTAACTCCGTCTCCAGTATATCGTG
CTTCTCCAACAGCAGAGTCTTGGTCTTTGGTCCGTCGTTTAGCAAAATGTGCGTTGAGTTCGGGTACAATTGACCGCTGGTTCGAAGCAGCTTCATTTCG
TCGCGAAGGTGGTGGAGATACCCCTCCGGGAAGGCGTTGCGCACCACGTAGTAGCCATCGGTGAGCAG