Description :
From Genome Similarity Track
Location :
contig_95:45131- 49523
Transcript NameFunction/comments
g10877.t1hypothetical protein

Sequence
4392 bases(100 bases per row)
GATCTGTTTACACTTGATATTTGTATAGAGATATAGGACTAGCCAAATGATGACCTACAGAGGCTCCCAGAGCTGTAGGATAAGAGAAATAAATCAGCAG
TCTTCCCCACAAGCCACCAAGGGTCAAGTCCGTCTTCGGTAAGTCTAGCTAGCTTGTCTTAGGGTCTGGATACGCTCGGCTGCGTGGGATGCCTGTCAGC
GAGCTTGAGGTACATTGAACCGAGAGTTTGTTGCTGGTCAGTCCAAGAGATAGGAGTGGCCGAGAGTTAGGGCGACAAGGAGTGTCGGTCCCTATATATT
GGTGGAACCCGAGTGTTCCCAAGTGTATTTCACTACCCGCCGAGGTTACCCTCGGCAAACCCGTATTAGGCGTGACTGCCGGTACCCTTACTTCTGAGGG
ACTGCGGGGGTTCGCGCGAAAGCGCAATATTGCATTCTAGCCCTCGCTCGTGGCTAGTAGTGCAGGTTTTAAGGTTGACCGAACTCAACCTTGGTATACA
GAGGCGCTTACAACCAACCCGGTGTAAGGGATCGTTCCTGGTCTTCAGGTGTTGATCCAACGTTCGCTGACCTTTCGCGAGGGAAGCGTGTGTTGTTGTG
GGACTCATACCGTTCGGTAGTGAGATTTTCTGCGTGTTCCTACACGACAACTGGTGCCGCGACCCGGGATTGGTGTGACCTTCTGTGTGTCTTGGTTGCA
TATAGGTTCTTACCTTAACGAGCATTCGAGAGAAGAAAGAAGAGAGAAGAAAGAAGATGGCGAAAGAAGCGAAGTCAGCGGTACCAGCAACGCCGGCGAG
GTCAAGTGGAACGCGTACCGAGGGTTCGGGGCGTTCCGGTTCGTCGTTCGCGACGCCGAGTACGTTGGCGTCGATCAACGAGCGTTCGGACAGTTTTGAT
GAGCCGATGGACTATTCTGACGCCAAGGAAGATGACGAAGAAGATGACCTGGAAGAGAAGGCAGCTATGCCCGAGCTTTCGGAAGCCGCTGCAGTATCTG
CAGGACGCAGCGGAGGGGTGAGGTCGCTTGCGCGAAACCTCACCGAAGAGTTGAACGAAGTGGCTGGTCCCGAACCAGCCAACGGTTACGACGAAGATGA
GTCCGACGATCACCGATCGTCGGCGATGGCCGAGGATGCGAATTCTCGGCCGAATGGCGGCCGGCCTCCTCTTAACGGAGACACCCCGGCCGCCAACCGA
GTTCTGGGTCGATACCTAGAACTCATGAAGGTGAAGAGCAACTGGATGCGATCCTTCGCTCCAGAGGTTGTTCGCCAAGCCATCTGGATGGAGCTCGGTG
GCGAGTTAACTGTGCCCGTGGAGGCGTGGAACTCGGCAGGTGGCCGAGGACACGGTGCAACTCCTACGCGCTATGGGATGTGAACCCCAAGTGTTCCCGT
CGGAAGCAGACCTCCGAGCATGGGCACCCGAGGACGCCGCTACGGCGCTTCGCAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGG
AGTTAGCCGTCCACCGAACGTCCGCCACGCATCGGATCCGGTCGACCCGTCCATGATTCCGTTGCCAGTGACCCCTGGGAGACGCCCCAGAGGGTCGACC
GAGGCCGGAATATTTTCGGCCCAAGGTGCGACGTCGACATATTTCCAAGACTCTCACATGGTGACGCCGAGGTCGGTCAGTCGCACAGAACGACTGGCGA
GAGAGGCCGAGGGATATCGAACCGCTCCGACTGCTGGACGAAGCGCAAGTCGGACGCCCAGCCGACGTTACGACCTCCGCGATGACTCATCTGACGAAGA
TTCGTTCGACGTCGGAGACACCGGGGGTGACTTGACGGGAGAATGGGCACGCCAAATTCGTGAGCTGAGCGCTGTGGGAATGACAGTGCGACACCGAGGC
TAGAGATCGCTACGCATCTCCCACTCGGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCGAGAAGTCCATGCAGTGGCTCCGAGCGTTCATATA
CGAGATGAAAGGGACGCACACGCCGCCCAACGAATGGTGCATGGCGTTTGAATTGAGCCTCCAAGATGGTGCTCTGCATTGGTACCGACAGCTGCCCCGC
AAAACGAGCGCACGTGGAAATTGTTGAGCGATGCGTTCATTAAGTACTACTGTTCGAGGTTCAACCAGTCTGCGAAGGCTCGGTACTACTCGGCCAAGCG
AGAGGAGAAGGAGCATGTCTGCGACTACCTCAACCGACTTAACGGCTATGCTCGCAACGCCGGAGTGCAGTTCGAGCATGGCGGTCGTGATGCAAAGGAC
CACGTCGAGCATTTCTTGGATTCGTGCGAAGACCGAGGTCTAGAAGAGCGTCTGTGCCATGTCCGAGTTAAGAACATTCACGACCTCGAGGATATGATCA
ATGATATCCTTCGTCGCAGAGAGCGAAAATCTGGACGCGAGTCCTCGGTCCGCCGCCCTCGAGGGCAAGAGGTAGCACGCCGACGCGATGGTGGACGCTC
CGAGGATCCGCGGGACGGCTATCGCCGAGACCGACGTCACCGAGAGGACGACCGTCGTCGAGAAGACCGTTACCGAGACGATAACCGTCGCCGGGATGAC
CAACAATATCGACCGAGGGTCACTCTCACTGACGCACTGACCAACATAGTGACAGCACTGAATGCGGGACGCTCGGTGGACGCGCGTGGAGGATACCCGG
AAGCGTACAACGACGGATATGATGACACCGAGGAGTATGGGCCGGAGTCTCACTCTGGCGATGACGACCGATACTCCGAAGGGTACTCGGACGACGGATA
CGCGTCGACCGAGGACCGAGGCCACGTGGCTGCTGCAAACGACTCTGAACGTCGCAATGCGGCTGAAGGAACGTTCGCTCGCGCCGACAACCGTCGGCCG
AGGGCAAGTAACGGCCAACGCCCGTATGACCGAGACGACCAGCGCCGAAACTCCACCGGACGCGATGGTCGACGCCAATATGGTCCATGCGCCGCCTGCG
GAGGACTCACCCATTCGGCTCACTACTGCTTTAAGCGATGCAAGATGTGCAAACAGGTTCATGATGCCGGGAAGTGTGAAGCCTTCCAAGAACTCACGAA
TCTCCTCCGAGCTAAGGTCGAGAAGAAGGACCTCTCGCCGGAATTGCAGGAACTCGTCTATGGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTG
GGTTGGTCCCAATCGGGCTGCCACAGTTAGCCAAACCTGCGCTGGATGCGGACTATATGTTCGCATTCGCAGGTGTGAGCAAACGGCCTGATGACTTGAA
TATGGAATATGTGAAAACGACGGAAAATGTAAAGGAGAGAGGCGTAAGCCTCGGTGAGAGTGAAGTGAATGGACGACGTGTGGACGGAGACGGAGTGGAG
CTAACCGATGCTTCGATCCTCAGCATGGCCAAAATCGACCATCCATCCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGGTGGT
GGTCATCCCAGCGCTATGACAAGAGGAAGCGATTGCGAGCCCTCGTCAATGGGGCTGTAAACGACTCGCGAACGAGGATTCTGCTGGACACTGGAGCGAA
TGTCAGTGTGATTTCCGCGTCATACGCGAAACGGTTGCGCTTGCGCGAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCGAGGAATTAACCCAGGGGTG
ATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGGAGCGCGTGTACGAATTTGAAGTATGGGTTATGGATCACAGTGCAGGAGTGGACG
TGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGATCTGTTCCACGGTACTGCGAGACTACCGGACGAGGTAATGGTGCCCCTGGTGAA
GTCGCAGAACCCAGCAGAGGCCGAGCCGTACAGCATGCAAGTGACTGGACGCCCGACCGAAGATTTGTCGGTCCCAGGGCGTGAGTGGCGAGAATTTAGG
TTACCACGACGACGGCCGCCTCTGACTACTCACGACGTGTGGGCACGCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGAGGGCAGCCGA
CGATGGTGCGACTAACGAACGTGTCACCGAAGATTGCTCACTGCGCGAGACACGAATCGGTACTGCTGTGGGTGAAAAAGGGTGACCTGCCGCAAGGGAT
GGATACACTCGTTTGAACTCCGCTAAGTATGAGGAGTGGCAAGTCCTGGCGTACGCGGAGTGTCGAGACGAGACTTTGTTCGCGCGGGAACGCAAACTCT
ACGAACGATGGTTGGCAGATCAGCCACCAGCTGTAGAACGACGAGACTATCCGACACCTAGCGGCATCCTACCTCGACCATCCGACGACTTG