Description :
From Genome Similarity Track
Location :
Scaffold_292:4513- 5647
Transcript NameFunction/comments
Phypl_g6546GTP-dependent nucleic acid-binding protein engD

Sequence
1134 bases(100 bases per row)
CTTTTCGAAGTCCGAGTGGATCACGCCAGCCGCCACAGCTGCCGTCGACCCGGCCAGCACATTCCAAGCACGCGCCTCCTTCTCACCAACGGTGTAGTAG
gtctgaagctgcagcagctcctggctGGCACGGATGACCTTCGTCAAACCCGTCTCCGTCAGACCGCTCTCGTTCAGGTACTCCAGCTGACTCTCATCAT
CTCCAaaagacgcagcagcttcctcaaGAGAGCCCGACACCGTCAGGCACACGCTCCCTTCCGCCTCCACACGTTCACGCACCGCCTCCGTCATCTCGTT
GCCCGTAGCAGCGTCATCCTCCGACACGTTGCACAGATacagcgccttcttggccgtcagcagctgcagacgctcgaaCTGCAGTAGCTCGTCTGATTTC
TCGAACACCATGCTCTCAGCAAGGTTCCCGTCTTCCAAGTGGGGCTGCAGAcgcttgagcacctccaTCAACGACGGCATAGTCGGGTCCGTCGATCTAC
ACAAAACCAACCAAAACTAAGTCCCAGCTCCCAGCCTCCTCAACACAACTCACTCAAAGCCACCACctacttcttcttcttggccataTTGGCCAGCcgc
ttctccaccgtctGCAAGTCGGCCAGGATCAGCTCGGTACGAATGGTCTCCAGGTCGCGGATCGGGTCCACCGACTCGTCCACGTGGAGGATGTTGGTGT
CCTCGAAGCAGCGCACCACGTGGGCGATCACCGCCACCTGCCGAATGTTGTCCAGAAACTTGTTGCCGAGTCCTTCGCCGTGCGAGGCGCCGCGCACGAG
TCCGGCGATGTCCACGAATTCGAGCTGCCCAGTTGACAAAATCAAAGCGTTCTCGGTCAGTTGCAGCAGTTTCCGCATTGCAAACGTTCGGTTCAGCCCC
GACCTGCGTCTCGATCACGCGCTTGGacttctccacctccgccaGGTGCcgcacgcgctcgtcggGCACCGCCACGCGCGCCACGTTCGGGTCGATGGTG
CAGAACGGGTAGTTGGCGGCCTGGGCCACCTCGGTCTTGGTCAGCGCGTTGAACAGCGTGGACTTGCCCACGTTGGGCATGCCCACGATGCCCACGgagc
gctggaagccgcgGCAGCCCGAAGGCGTGCGGGT