Description :
From Genome Similarity Track
Location :
contig_43:451174- 452985
Transcript NameFunction/comments
g6410.t1hypothetical protein

Sequence
1811 bases(100 bases per row)
GCTGGGCCAACGTGTCATTCCCCAATTTGCGGCGTAGAGCTCAAGTCGCCTCCGCCCATGGCGCCCAACTCCGCCAGCAAGTCGGCGCTGCAAGATGCCG
GGGAGCAGACGAACCTGCTGCCCGTGAAGCGCTCGGAGGCCGCGCGTCCGCAGTACCGCTCCATCATCGTGAGCGTCTGCTCCTTCATCCTCGTGACCGA
GTTCTGCGAACGCCTGGCGTACTACGGCCTGTCCGGGTCGCTGCCATCTTCTTCCACCGCAACCTGGGCCTCAGCACGGTGCTGGCCACGGAGCTCAACT
CGACGTTCACGTCGCTGTCGTACCTCACGCCGCTGCTGGGCGCGTACGTGGCGGACCGCCACCTCGGCCGCTTCTCCACGATCGTCGCCTTCTGCTCGCT
CTATCGCGGGGCTCGCGCTCTGCGTGTTTGCAGCGTTGCCGGCCGTGTCGTCGCTGCCTCTCTTCATGCTGGGGCTCTTCGGCGGCGTGGGCTTCGGAGC
GGGAGGCATCAAGCCCAACGTCGTGGTGCTGGGCGCCGACCAGTTCGACGTCGACATTCCGGCCCAACGCGCCGAGAAGGACAGCTTCTTCAATGGTTCT
ACTGGGCAATCAACGTGGGCGCCACCTTCAGCTACGGCGTGCTCACCAACTTGGCCGTGAACGGCCTGCCGCCCTACATTTCGGCCGACTATGGCTTCTT
CGCGTCGTTCGCGATCCCGTCCGCGGCTTTCGTGCTGGCGGCGGTCGTGTTTTACGCCGGCAAGGCGCGGTACCGGCGCGTGCCGCCCAAGGGCAGCGCG
CTCAGCAAGTTCTTCTCGGTGTTGGTTCAGGCCGGTTCACGCTCAACTCGCGGCAAACTTGTGCTCAGTGGCGGACTGGCCTTCGTGCCGGGTATCGTGC
TCACGACGGCCTCGTACTTCATCCAGGATGACTTTACGCACATGGCGGTGGCGCTCGCTGGCGCGGGTGCTGTGGCGTATGGCACGTTTGTGCTCGTTTT
CTCGGGAGCTGCGACGGACTGGCTGAGGCTGGCGACGCGCACGAACGGCGGGTCGTTTTCGTCGCAGGAAGTGCAGGATGCGACGCAGGTGGTGCGTCTC
GCGCCGTACCTGGGCATCATTATCATTTTCTGGGCTGTGTACGGCCAGATGAACTCGAATTTGTCGTGCAGGGCTGCCAGATGGCCTGCGTGTGCAAGGC
AGTGAAGGGGCTTCTGGGAAGCCGGTGCTGCTGTCCTCTGCCATGCTCAACGTGGTGGACTCGGGCGTGATCTTGGTCTTTATCCCCGTGTTTGACCGAT
TGCTGTACCCGTTGCTGACCAAGATGGGCATCTACCCGACGCTGCTGCGGAAGATCGGCGCCGGTCTGGTGCTCGCAATGCTGGCCATGATCGCGGCTGG
TTGGACGGAGCAGATCCGGAAGAGCAGCCCCATGATCGAGGGCGTGTCTTCCAACTGCAGTGCGGCGGGTGAGACTCTGCCCATGTCTACGATGAGCGTT
TGGTGGCAGACGCCGCAGTACGTTCTCGTTGGCGTGAGTGAGATCCTGACGAGTATCTCGGCCTACGACCTGTTCTACTCGGAGGTGCCCGAGTCCATGC
GCAGTGTTTGCCAGGCGCTCAACTTGCTCACGACGACGCTGGGCTTCATTGTGGCAGGAGCGCTGAACAGCATCTTCTCCTTCTGGGTCACGAGTGACCT
GAACGACGGCCACCTCGAGTACATCTACTACATGCTGGCGCTTCTGGTTCTCGTGCTGCTGGTGGCCTTCATGTTCGTATCGCAGTCGTTCGAGTACCAT
GTGCCCCCGCC