Description :
From Genome Similarity Track
Location :
Scaffold_1:451157- 453173
Transcript NameFunction/comments
Phyin_T30-4PITG_00045Myosin-like protein

Sequence
2016 bases(100 bases per row)
TGCAGGAATGATGGTCACCCGATATATAGGCACTAACTGGTGTCTGATTGTGTCCCTTGACAGGACGTCGTGGAGGATCTGATTCAACTCCCACACCTAC
ATGAGCCTGGTATTTGCCACACGCTGAACGAGCGCTTCAAGATCAACGAGATCTACACTCTCACAGGCGAAATCTTGCTAGCTATCAACCCCTTCCAAAA
CCTTGGCATTTACACTGATAAGATCACACGCAAGTACATCCGCAATGGCGACAAGCGTGCGCTAGGACAGGAAGTAGCGGACATGCCACCGCACGTCTTC
AGTATCGCCGACAAGGCCTACCGCTCGCTCGTCGACCCAATCGGTCACAGCTCCAGTGGAGGCCCAGCCAACCAGTCGATCCTAGTCAGTGGTGAAAGTG
GCGCCGGTAAGACGGAAACCACCAAGTTCGTGATGAACTACCTGGCCACCATCTCGCAGCACAAGAACACCTCGGCCGACAGCAACGTCATGAAGCAGGT
TTTGTCGTCCAATCCGATCCTCGAGTCTTTCGGCAACGCGCGTACGATCCGCAACGACAACAGTAGTCGTTTCGGTAAGTTCATCAAGATGGAGTTCTCG
TCCGAGGGGAGTCTCGTCGGAGCGTCGATCCAGACGTATTTGCTGGAAAAGGTGCGTCTCGCGTACCAGGCCGAGTCGGAGCGTAACTACCACATTTTCT
ACGAAATCATCGCTGGAGCGACCGCCGAAGAGAAGAAGCGATGGAACCTTAAGGCGCCGACCAAGTTCCACTACTTGAACCAGAGTACTTGCGTAAAGCG
TAAGGATGGGGTGAACGATGCCGAGCAGTTTGGTGTCCTGAAGAGCGCCATGCAGACGATGGGCTTTGACGACGATGACATGGAGAGCATTTTCGTGACG
ATCTCGGCGTTGCTGCATATCGGCAACTTGGAGTTCGATGAGACCCACCACGCTTCGGGTACAGAGGGGTCTGAAATCTCCAACATGTGCGAAGATTCGA
TGAAGGTGGTACTGGATTTCCTGGAGGTCGACAAAGAAGGTCTAGAGCTGGCGATTTGCAACCGCAACATCCAGACCAAGGACGAGCATTACTCGATTGG
TTTGCTGCCTGATGCCGCTGAGAACGCGCGTGACGCATTGGCTCGATTCCTGTATGGCAAGCTGTTCGACTGGCTTGTCAGTCGTATCAACGAGATCGTG
GAGAACGAGGACCGTGACGTTCCGTTCATTGGTCTGTTAGATATCTTTGGCTTCGAGGACTTGGAGCACAACTCGTTCGAGCAGCTGTGTATTAACTTTG
CGAATGAAACGCTGCAACAACATTTCAACCGCACTGTGCTGCGTATGGAGCAGGAGACATACGAGAGGGAGGAGATTCAGTGGAGTTTCATCAACTTCCC
CGACAATGGTCCGTGCATCGACCTGATTCAGGGCAAGCCGTTCGGTATCCTCCCTGCTCTTGATGAGGAGTGTATTGTTCCGCAGGGTAACGACCAGAAT
TTCGCACGAAAGCTGTACCGTCAGCACGAGCTGAACCCGCACTTTAGTGCGACCAAGACGGAGATGGCTAACCACCTCTTTGTCGTGCACCACTACGCTG
GCGCTGTCACGTATGACACGTTTGGGTTCTGCGAGAAGAACAAGGACATTCTGTACCCGGAGATCACTGCGATCATCAAGCGGTCGTCGAAGCCGTTCGT
GCGTGGACTTTTGCAGGTCGCGCCTGAGAAGAAGACGCCGGCTAAGAAGACCAAGGGTCGAGCTTCCAGTACTGCCGCGCGCGTGAGTCTGGGTCTACAG
TTCCGTACCCAACTGAAGACGCTGCTGGAAACCATCAACGTCACCGACTGCCACTACGTGCGCTGCTTGAAGCCCAACGACAAGGCCAAAGCCAACTTGT
TGGTGCCCAAGCGTGTGTGTCTCCAATTGAAGGCAGGTGGTGTCCTGGAAGCTGTGCGTGTCAACCGTGCTGGATACCCCGTCCGAATTGCTCACCAGCA
GTTCATCAAACGTTAC