Description :
From Genome Similarity Track
Location :
Scaffold_129:45110- 48660
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_14408myosinlike protein putative

Sequence
3550 bases(100 bases per row)
CTCTTTCTTGGACCCAAGCGTCCGGAACGTCGAGCCCCTCGGCTTGGACGACGCCGATGTCGGCGCCGATGGCACGCCATTATGACCCGACGCACGGAGC
TTCTCGAGGTCTTTCTGGAGCTGCGCAATCGTCTTGTCTTTCTCCCGACACTATAAAACACACATTATTGGCGCGATATACGAGGGTCCAAGGATATGTA
CAAGATCGTCTTGCTGGCGCAGCTTGAGCTGGTGCGTCGCGAGAAGCATCTCCTTCTCTTGCTTGAGCTTGTCGCACTCGTCCCGCATCGTATGAAACAT
CGTCTTCATGTCGTCGTTCTCCTTGCGGAGACGCGCATTGTCGTCGTAGATGCGGCCAATCATGCCGTCGGCGTCGGCCATGACCAGCTGCGCACTCGAC
TTGCTCCGCTGACGGTGGAGAAGTGCAGCAGTCGTCGACGGCGCGGGTGCGACGACCTCTTCCTCGTCTTTCGTCTGCTCGACTTGGAGCCGCACGCGCA
ACGAGCGGAGCTGCGTCGACATGGTGACTTGCTCGCGGTGCTCGGCCAGCTTGGTCCGAAAGTTCTTGCGCTCCAAGTGCATGCGCATCGCCGCTTGAAT
CGTCGTCGCCGCGCGCTTGAGCCGCACGAAGCGTTGCCTACGCGCATCATGAGTGCGCGCACTTGAAAACCATCAACATAAAAAGTCTACCGGACGGCGA
ACCCACGGACGTGGCTTAGCACAATGAGGGCCTTGTGGCGGCGCTGCATGACGGCAAAGACGCGACGCGCCTTCACGCCGCGCCAGCGAGCTTGGAGCGC
CAGCATCCCGTTGTAGAGCGCATGGTACCGCTTCATCGCGAGCACACAGCGCACGACCGCCTACGCCCGTGTTGAAATGCGCGTGCTTCAAGTGCATACG
AGGCGCACCTGGAGCTTGACGATCGCCGCACGTTGGCGCCGATAGTGCAATCGGGCGAGGCACATGCGCGCAAAGCGCTGAATCCGAAGTGCGTGCACCG
TCAAGCGCGTGCGCTTGATTTGGTCGAGCGCTTCGAGGACGCCGGCCTGAAAGTACACCTTGGTCCGGCCCAGCTGGTAGTGTGTCGGCGTCTCGAGGTT
CAGGGGTGCAATGAGCTACCGTGTTGATACATTGATACCATCGTGAAACATGAAAAAAACTACCGAGGCGCACTGCTCGGCGGAGCGTCGAGACGCAAAT
TTCCGGTCCAGCAAGACACGGTAGAGGTCGAGGAACGCGTCGTGCGTGTGCCGAATCGGGTACGCAGCGCGGGCGATCCGGATGGCTTCAATGACGCCGG
CGCACCGCAGCTGCGCGACCACCATCGTATGGTCCAACACGCCGGGCTGCTTGATCGCGTTGGGCTTGATGCAGCGAATGTATTGGACGTTGGTGGCTTG
GATGTTGGCCATGAGGTCGGCGAGGCTGGCCTTGAACTGCATGCCGACCGTCGTCGTGTTGAGCGCGCGGCCCTGCCGGGGCGCCGCCGGCTTGCCAAAG
AGCTCCGACACAAACGGAATCGACGACGACCGAACGAGGTCCGCGAGGTCCGGCAAGAGCGCGTCCTTGTGCTTTTCCAGAAAACCAGTCACCGTGTACG
TCACGGGCGCCGCGTAGTGGAGAATGGTGAACTGCGCCTTGTTGGTTTTCGGAAACTCAATGACCGTGTTGGCGTCGTCCTTGTGGAGCGTCATGGCCTT
GGCGACAAACGACTCTTCGTTGCCCTACGCGCGGTGGTGAGTTGCGAGTTGTGGTAATTTTTCAAAATTTTGGAGATCTTTTTGAAGACTTTTTTCAAGA
TTGTTTTCAAGAGGGTGACAATGTAGCGATGGAAGCGTACCCGCGGTCGCATGACTTCGTCGTCGAGGAGCGAGAGGAGCCCGAGCTTGGACTCGATGAC
GGCGAGGACGTCAGCGTTGTCAAGGAACGCAATGTGCGCCCACCGAATGCCTTCGTCCTCGTACTCGATCTGGACCGTCTTGAAGACGTCTTGGGTGAAC
TTTTGCTGCAGCTTCTCGTTGGCATAGTTGATGCAAAACTGCTCAAACGAGTTGGTCGTAAAGTGCTCGAACCCAAAAATGTCGAGGACGCCAATGTGAT
GGGCCATGTTCGCGTCGTGACTGAGCGACGCGTTGATCGTGGTCACGAGCCACTCGAAGAGACTCGCATACAGTCCTTTGGCCAGCGCATCGCGGCAGCC
TTCGGCTTCGGCCTACACACCAAAAACATCGTTTCGTATCAATGTATCAAGTCTGCCCAAGTTTTGAAAACTCAAATTGGGCCAACATGGAGACCTTTTT
CAGATACACTTGAATCGTGTCGGTCGACGTCCGCACGGTACGCGAGCAAATGGCCCGCGTGATCGCCGTCGTCTCGACACCGAGGAGCTTCCCGATCGCC
ACGAGGTGGCCCGTCGAGCCATGGCCGATGGTCGACATTTCATCGCCCTTGGCTTCGAGCTGGAGCTGCCCGAGGTGCAAGATACCGGCGAGCGTTTGAA
AGAGCGTCGTCTGCGCCGCCGCCGAGAGCCCGAGGCGGGACAGCGCCTGTGTGGTCTTGGCGAAATGCGCTGCGTCCGAGTCGCCTTCGATGGCCGCCAC
CGTCGTCGCACCCGTGTACGTATACGTCTCGGTCGGGTCCAAGAGGCAGTCGGGGCCATTGGCCGCGAGAAGCTATGGAGTTGCAGCGTAATTTGCAGTC
AAAAGATGGATACCTGGTAAAAAATGTGGTAGTTGCGCTCCTGTGGTTCGTGCGACACGACGCGTGTCTTCTCGAGGAGGTACGTGTTGCACTTGGCGCC
GACCAGCGTGCCCTTTGCGTCAAACTGCAGCTGCGTAAATTTGCCAAACCGACTCGAGTTGTCGTTGCGGACCGTCTTGGCGTTCCCGAACGACTCGAGG
AGCGGTGAGACATGGATGATCTTCTCGATCGTCGAGTCGTGGAGGCCGCCGGCAATGGCCGCGAGGTGGTGCATGAGGATCTTGGTCGTCTCCGTCTTGC
CCGCGCCCGACTCACCGCTGACGAGGATGCTCTGGTTGCGCCCACTGCGGCGCATGCCATTGTACGCGCCGATCGAGGTGGCGTAGACGTGTGGCGGCAG
CGACGCTTTCGGCTCGTTCAAGTACTTGCGGTGCATCTCGTCCGTGTAGAGCGATGGTAGCCACTGGTACGGGTTGAGCGCAATGCACATGTCGCCCGTG
TACGTGTACGGACGCTCGGCGAGGAAGCGCGCCTTGACGTTGTACAAGATCGCGGCTTCGTGGAGGTAGCTGAGCGTGATCATGTCATCGACGCCGACCG
CTTCGTTCTGCATGGGCAGCGCCGACGACGCGCCGGCGTTCTTGGCGGCCATGAGCGCCAGCGTCTTCTTGTCGCGCAGGTCGATCTCGCGGACGCTTAC
CGCGCCGTCGAGGCCGCGGACCTTGGCGCGGACCGTCTGCGCGACCGGGTCATGGGCGACGACGTCGGCCGGTAGCCACACGTGCGTCTCGTCCGGCACG
TACACACGCGTCCCAGCGACCATCTCGAGGCCCATGCTGCTCTTCGTGTC