Description :
From Genome Similarity Track
Location :
Scaffold_1309:4510- 8745
Transcript NameFunction/comments
Phyag_g10242hypothetical protein PHYSODRAFT_466642
Phyag_g10243protein kinase

Sequence
4235 bases(100 bases per row)
CAAGGCGACCCACTGCGCACGCCGTTAAAagcgcagcgcagcgcagACACCCGTCTATCTTGGCCattaaagatactggggaacttcccgggaccacgtc
tgaccactcggccCGACTTGACCgacttgaccaccttgaccacttcctgacgctgtccccggaatgattttgaccaCTGaacgccttccaaaattgacat
accaccccgacatccagatagttaagaaaacgtatattgatccagaccatttttCCGTCTGACGANTACTCGGTGTTTGTAAAGTCCgactcttttctag
caacgAAGGCAGACCTTTTTTGACATATAGCGACCTCTACACAATTTAGATTTAGAGCCAAATTCAGAGATGCATGATATGTCGATTGTATGTCGATTTT
GGAAAGCGTCCAttcggtaaacgggctgctggggagtgaaagatgtagtgccttcattcataggtagcccagtccgaacgtaaagatctctagagatcat
tcttagtgaatatacctgGCCGCATCAGCGAAATGGCAGGATCTCCTGATAGGCGCCGAAGTGATCGCGTCTCGAAGTTCATCACAACAGTAACGTCGCT
CACACGGACCCCATCTTCGGAGCCGCACATTGGTGTCACAGCTGTGTGGCCGTCACAGTGGTCGTGCCTCCGCATTGATTGAGGACAGCTTGCTCGACAG
ATCAAGCCACGGCGCGCTACGCCCGCTAACATTAATAATAAGCGTGGAGGTTGCAGCCTTGCTCGAGAAACAGCAGCCTGCGGTCGCAGTGCAACCTCAG
TTGGTAATCCTATCTCGGTTCGTCGCGAGAAGGCCATCACCTCGCTCTGCAATGGCACGACGCGCATGGGCTCTtctccgccagcagcagctttcacaTT
GCAACAACCGGAAACTGCGGGACTTTTGATGGGCGTTTCCGAGGAACGTTGAGCCTTTGGTAACGGCCCGAACAATACTGAACGCAAGTCAAACCGCCAC
TCTATTTTGCGCCAATCACAGCGTTTATCGCAAGCCATTTTTCCACCAATGCCGTTTCCGGTTCGTTATTCACGACTGGCTTTACGCACTGTCTATgcgc
acttgctgcagtgggACATTTACTGCCGTGGACCGACACAAGGCAAGTGCCGCTCCATTTGCACTCCGACGCCCCGACGTCCGAGCGAGCGGCTACGTGT
GCGCCACAACGCCTTCCCCCCGTGGCTCGAATCCCTCCCTCCCGCTCGTGGCAAGCGCGAAAAAGACACCAGAAGCTTCGTGTCGGTAGGAGGCcagttg
cagtcgctccaAGTCGACCCAGATACGCTACACTACACGACACCAAATTCCTACGAACCAGACACAAGATCGTCAATCGGAGGACGCAGAGCGTTCGGGG
ACAAAGTCCTAGTGGatttccaccaccagcagagAAGCTTTAGTAATAGTGCTTAAGAACTGGCAACATGCGCAACTTTGCAGCGTTCGTGGCGACGGCT
CTGATGATTGCTGGCGGCAGTGCAGCGGATGATGACACATGCTCGCCTCCGGAGAAGAATACGCTTACAAGCAATTGCTACAGGGCGTGCGGCTCCTCGC
TGTGTGTGAATTACGCCCCGTCGACCGACCGAAGCaaggacagcagcgacggcggctTCTTCTACCGCGGCTGCTCGTCGGCCAGCATCCCCACGTGCAA
GACGAAGGCGGGATGCGAGTTGCAGTGCCTGGTGGACACAAGGGATAGCTGGGGGATGCCGCAGTGGACGCTGAACATCGCCCAGCCACAGAGTGACAAG
GCAGACACAGCAGTCTTTGAAAAGATTGACGACCTTACGCTGCCGCCAACGCTGCAGAATTTGTACGTGGCAAACTACTGTAGATGACGGTAATGCTGGG
ACTCGGTGCAGGTCGTGTGACGCTGGTTTGTATTGTTGTGATTTGTAGGACGATCGTCGGTGCGACGGCGAGTTCGCAGATCACTGTCCCGCTCTCGTTT
TCGTCGAATGCCTTCCGTGGCGGCACAGCGTTGCAGCAAATGTGCGTGCTTTTTTAATTGGTTTTGTGGACATGGTGTTTGGGAGTACTGACACAGTTTG
TGACGTTGGTTTTTGGCTTACAGTATGATTTCGGATGTTAATATTGGCGATCTGCTCACGAACATTTTTCCAGACTTTCTTCAGACGCTGTAAGCTTTTA
GCAGTGATCTTATCGCGTGAAGTTCTTTTTTCCTCTTGAGCCATGTATTAACCAACTTGTGTGTGTGTTATTTGTGCAGTATCATTCAGCGGTCACAGCT
CACTCAGTTTGATCCGCGCGGCTCGCACCCGTTTACATCCGTATCTGTCTTGTACGTTCGACTTCCTAATTTGTTGTACGCCACGATGGCGGTTCTAATG
TCGATCTTTGTCCATTGTAGAGACCTTCGCAACAATCAACTGACGGACATCCCTACCATTATTTATGAAATGCGCAACCTGTCGGCCCTGTATCTACAGG
AGAACGCTATCGTGGACGCCCACGTCTCTCTTCCTCAACTCCAATATTTGCAAAAACTGCCTGTGTTTGAAGCCGATTTAATAGTCAACGGAAGCTGCTC
CACAGGCTACGAAGCCGTATCGTGGGCAGACAAGAGTGTGTGCTACACAAACGGTGATGGTCTCGGGAGTATCAACAGCTCTGGTTCCAAGGAAGAGAGC
ACTACTTCCACAGCTAGCGTGAGCAGTGGCAGATCCGTGGTGCTCTTTGTCGTTCTTGGCCTTACGCTATTCGTAGTCTTGGCTGTGGTAGGCGGCGTGG
TGCTTTTGCGGAGGTGGAAGAAACAAGCGGCAAAGGATCAGCACGATTCGCTTGTGTCTGCGGATGGCAAAATCAAGACCAACCTGAAGAATTTGAGAGC
ACGACTGGGCACCCAGTTGGGTAACGGTACAGCCCAAACTACGGATCTTGAGGCTTCGCTGAACGAGTATAACACTGGAGGTGGGCTTCGCAAGGCTGCA
TTTAAGGAGATTCCGATCACAGATATGGTGATGCTCAACCAGTTGTCAAGTTTGGGCCCCGTTAACGTGGCACTTGCAGAGCACCGCACCCGTTTGGTGC
TTGTGACGAAACTTCAGCccagtgacgatgatgtgGAGGCTGCTTTGGATATGGTCCCAACACTTTCGCAAATGCGTCACCCTCAGTTGCTTTCGATTAC
TGGACTTGTGTGGGACGAACGACATGCAATGACTGCCGTGTGTGAGTACATGACGCTGGGCACGCTTGAAGCATACCTCCGAGGTTCTGGTTCGGAGCTC
AACTGGAAGAATTTCAAGATGAAGGCGGCAGCTGAGATCGCACGTGGGCTCATGTACCTGCACAACCAGCACATGGTTACTTACGACGGGCTCAATGGAC
GAAGCGTTTTCGTGGATCCCAACAAGGGCTGCAAGCTGAACCCGGTGCAGGCAGCACTCCCTACCAACGGATCATCGCCCTACAGCTGCCAGTCGTACTA
CCGCGGAAGCGACTCAACCACAAAGGCGTTTTTCGCTCCTGAAATCCTCATTGGTGAACCCTCTCGGTCGTCTTCAGACATGTACGCGTACGGCGTGCTG
CTTGCGCATCTGGACACGTGCCAGACAGCAGATGAAATGATCCGAAGTTCGTGGAGAATGCGCACACATATTGGCGACTTCGACTCGGACAATGGCACTC
TTCTTTCGACCGATGGAACGGTTGTATCGAATAGTACTCCTGTCAGTGATCCTGACAACTCGCGACGGCGCACCACCCAGCTAGAAGGCTTGCCCAGTAC
AAACAGCTCTTGTGTCCTGCAAAGCTCGCGCAGTCTCGCTCTGGAGGAAAATCGACGACGAACTACACCTGTGCTGGGAACCcacaacaacgacgacacg
AGCTTCATGGGCATGTTCACTTTCACCCCCGACTGCCCCACGATGGTCCGGGAGCTGGCAGGCGCCTGCTTGCAGTACGATCCGTCGCTACGCCCCAGCG
CGTCCTACATCGCAGCTATGCTGCATATCTAGGCAGGCCTGCAAGCCTGAACGCAGAGATAGTATACAACACCATAACTCAAAAAAGTACAATACCATCA
ACATTGACCattcgagtgctgctggttgaagcgggtatattcactaagaatgatctcgagagatctttacgttcggactgggcgacctatgaatgaaggc
actacgtctttcactccccagcagcccgtttaccg