Description :
From Genome Similarity Track
Location :
scaffold_243:451- 4742
Sequence
4291 bases(100 bases per row)
ACGAAACACTTCAACCAGGGTTGCTTTCAAGTGGCAGGAAAGCAGATGGCAGCAAATGCGAAGAACGTCGTCGCGTGAAACTTTGCCAAACGATTGCGAA
CGTATTTTAACTGCATCTCACGAGGTTCTCAATAAAACATTTGCTACCGAGGTGTTTGACTTTAGGTACGTTCGTGAGGCTGACCAAATCATCGATGCCT
GCGCAAGAAGATCTAATGAACGAAAGGTGGCAAGATCAGCTGGGCCCCTCACGACATGATTAACTACAATATCTCTTAGATTATCGGTAACACCGGCTTG
TCCTTGTTTTCGTTGGACCTCTCGATTAACTACAACATCTCTTTCCAACGAAAACAAGGACAAGGCAGATTTCAAAGAGAAGCTGAAGTTCACTCTGCTT
CCGACAATTGTTCGGGGGAAGTTACTGCAAGGTTGACTCGGCTGGGCTGGAACCGCTGCTCAAACTCAGTCCTAGCCTTAGCCGCGATATCTGAGTTGTC
CACGACAGACAAGTGTGAACGCTGGAAGTCAGCTTGAAAATTGCACGCCTTGAATCGTGATATCTGAGCAGTGGTGCGGTCGACTCTTTTGCGTGGGCGA
GTTGGAAATCTGGAGACTGCAGCTCTCATCATGTGATCACGATGGACAAATATGAAGTGGGTATCGACCGACGCGAGGGAAGCGGAAAAGTAAAAGCCAA
AATGACAAGGCCAAGAAGACAAGGACATGAACGTGTCCGAATTGCTAGGGTTGCCGCTTGTGAAGACCCCAAATGGTAGAGCTGAGGAGTATGATGCAGT
GTGGGGAATTGATCTTGAATGGGCGAACTTCATCACGGCTGTCAACTACGGTGGAAAATCGCTGCGCTTCCGGACATCGTACTTCTAACGAGCAAGTGGG
TATTCTCGTTTTAATTGTAAGTTTAAACATCGCATCGACAAGTTTCCTTACGTTCGCGAATTACTGCTAAACACACATCAACGAGAACGACCTCGTCGAT
GGAGACGTTCTACAAATCCATCGAATGCTGATTTAAACACGGTCGCGAGTTACTTTCATTCTTCATGGATCCGTTCTTTCGTAAGTTGAAGTCACGCAGA
TACACTGTACGTATTATGAGGCTGGACCGCGCCTGCTTTTAATAGCGGATGCTTGAGGACTGTAAACGGTCATCGGCTTCGGTGACTGCGGCATGGCTGA
CGAGGGAATGATCATGTACAGCGTTGTCCGTCTAGTGAAAGCGTTCGCCCGTAAGCTTGCTTACTGTAGTGAGGTCGTGGTAGTAGTGTCAGACAAGCAA
ATCGTACTTCGACTGGCCCACAGCGAGCGATGTAACGAATTAGCGCTTCATTCGGAGGTAGCATGGCGGCATCGTCCATAACGTATCCTTCACAAAGTGC
TGCACGGTTTGACCAAAAGTGGGGCATGTGGAAAGTTGGTCGACATAGACGTGAACGTGGCTAAGAAAATCCCCATAGTGCTGCAGAACCAATTCACAGG
AATATCGAAACGGTCTCTCCGCCACCAGTGCTAGCCGAGATAAACCTATCTTCAGCCCATCCATCCGATGGGTGGTCTCACCTGTATAAGAGCACATTCT
TCCCATTGAGTAGCGTTGTTGACCGTTACTTACTCTTAGACTAAAAAGAAGAAATCTGCATTACGAGGATAGATAACTTCATAGATGGTTTCGGCCGCTC
AAACGCTCAAAACCTCAGTGGGGTATCTAATTTGTCGGGTTGCAGTAAAGCAAGCCAGATTACTTAGAAAGTTTAGTTGATTTCCTTTATGATGACATGC
TGCTGTAACTTGTGCAATTGTAAATTTTGATCAAACTTGCTGTCAACTATGGGTCGAATCGGTTAACACTCATCTGCCAATGTCAAACCACGTGACCTGG
ATTCAAAGTACAGTTTCGTACTTTTCGAGGGTATTAAAAACTTCAACGCAAATGCTGTGTCTGTCAGTGTTTTTAGTGTGCGCCCCTTATCAGTACGACG
ATACAAAGATGGCCTTAGCTTTTCATTGGCCCGAGTGAGATGAAAGTGACCCCGATTGGCTGAAAAGAGTGTAGTGTGGTTAACACAAACGTACTGTGTC
GTCAACATAAATACACTTGTATGAAGTGTGTAAAACAATGTAGTAAAGAATCATAATCACTTAGCACTTGATGGCACTTTGTGCTTAGAAGTGCACTCTG
TTGCTGCACATAACAAGTACTATCAGCACCTCGGCATGTGTAACTATTGTAAGTGTATTGTGTACCACCAAAACAATAGACGATAGACGCAACGAGCAGT
ACCAGTATAGGGGTTACCAGTAGTGACGCGACACGGTACTGGGAAAATCATAATACAACGGGCTATACAATATTGAGTTACACTGAAACAACACATGATG
CTGTGGTGATCCTAAAGCACCATGAGCGGATAGAAACAGGATAGATCAACACCATACATGATGCCCAGACCAACGAGATGCAGAACGTACACTATATATG
TTGCAAGGATCACACGCAACGGGGGTCAATAACAGGTAGATCAATGGATCTACATGATAATATGTCTAATATGACACGTGGGTGACGTCAATGCGATGCT
AGATTAACATAGTACTGGGAGCAACAAAGAACTATGGCTAACACGATACTGCAATCCTACCATAATGAAGTCGGTAGTATGAGCTAAGAGCACGCAGAGT
ATGCGTTGTAAAAGCACTACAAATATTAGGGCTCGACAAGACACAGAAGTGCGCATGGGACTACGAGCAGATCAGGATGGTACTAAAATTGTGAGCGACA
CAATGCGTGATACATTGAAGCGAGAAAAATGCAACGCGATGCTGGGACCAACACGATCCTGTGACCGTACACACAACGCGGTGGCAGGATTAAACGTGAT
ACTGAGTAGAGGAGCTCGTGCAGCGAGTGGGTCAAGTAGATTCACCACCAAAGCACAGCGTGGGATTAATATAGTGTAGCGTTGCAAGCGTGCAGTGGCG
AGCGAAATGGATGCTAACCAGCCAGTGACAGTAACGAAATGGGTAGTAGCTTAACAATGGCAGCTGAGCAGAGAGCACGAAGCTGCGAGTGGAACGGGCA
CTAACCTAACAGGGACAGTAGCTGAGCGAACGCGAAGCCACGAGTGGAACGGGTATCGATCGACCTAACAGGAACGGTAAAGTGTATGCTTTTTTGACGG
TCGTGATATTTTATTGGCTAAAAGTCGTATTATTTTCGTCAGTTGAATACTAAATTTTCATGGACCTACCAGCGCGTAGCGGTAGTAACTACTTCAAGTG
TGTCCGCGGTTCGATTCAACCAATCGACCTCGGAAACTTTGAGAAGAATGCAAAGTATTCGTCGTGCAAACGACAGCGTAGATCTTTCAGGTCTGCTAGA
ATGCGTTGTCTTTTGATGTCTTTAAAGTCCAATAACTCGTACTTGGCATCGCTTCCACAGAGAAAAGTTTTTGAAAGGTACTAGATAGCAACAGTTCGCG
CTTCTGGAAAGCACTAACTGATGATCAAAAACTCGTGTTACAGTGAACACCAGTGATAATAGTTGAAAGACCAAAGCTATTATCTATCTCACACTATGTT
CCTGCTGCAAGCAGATACCGCGAACGTCCTCGTCGCCGTCGCTTTCGTCATTGTTTAATAGTACTCACGGTGAGGTGGTGGTGGTGGCGGTGGATATCCG
TATCCGGGGGGAGGAGGACCATATCCTGGTGGTGGTGGGCCCTCGTAACCTTGCTGAACAACGACTGGTTGAACGTACACTGGTCGTGGAGAAGGCGAAT
CGTAACCTCGGCGGTCGCGGCGACCGTCGTTATCTGCGGCGGAAGCTCCCGCTAGACAGCACGAGGCACATGCCATGCCGGCACAACACGCACAGCAGTC
GTCCATGCAGCAGCAACCATCACACCCGTCGTCTGGTCCACACATCGTTGTTGCCTTGCTCCCTTGTTGCCTGCTTTACCGACTGGACCTTCTTGGCCTT
GCCTTCTCTTATGCGTCTTGGACTTGCTGCTCCGTCGGTAATTCTTCTAATGGTTCGCTCATTGAGCCTGGGCAAGGCTCTTTTCTCAAGGGCAGACTCG
CCATGCTATCGTCTCCATCACATGAATTGTGTCTCAGCAAAAATCTGATGATGCTCAGGTAATTTACCCACGCCGGGCATCATAATCCGCCGACAAGGGA
TCAGCACCGCTGTGCACCAGCCGCTTCTTTGTGCCGCGAGAACACCCTGTCCAATAGCAGTGCAATTTATTCATTATTCACGAGGGCATTC