Description :
From Genome Similarity Track
Location :
Scaffold_2849:451- 2719
Sequence
2268 bases(100 bases per row)
CGAAGACAGAAGGACTGCCAGGCGAAAGAAGGCCGCGGTGTTCGGATCCAATGATGGATCCACCGAAGACGGAGGATGAGCAAGTTTGTTACCATGAGGG
CGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGA
TCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAATAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGGGACCGCCCGCT
GCCCGCGGAGTCAAATGTGACATCGATGTCGACGCGAAACCGATCGCTCAGAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGAGTAAGGGCCT
GCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGAT
TACCGACTGGTTAACGGTCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAATGAGCTGTTGGAAGATTTGGATAAAGTACTCTGGTACTGCTCTC
TTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGAT
GCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCAATAACGCCCTCTATGGATTCACCCGAATACCGGAACCCAAAAGGGGTGGATCC
GGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTGGAACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTC
TAATCCCGGCGAAATCGTGGGATCAGTTGTGCGAAAGCGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTA
TTGGGGAATGCGCAAGGTGAATTACTTAGGCCATCGAGTTTCCAAGGAGGGATTAAAGGCGAATCCTAAGGACCTGTCTTCATTAGCCGATTTGTCCTTC
CCACAGTCGTTACGAGCGATGCAATTCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAAT
TAAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATGAAAATCCAACAAGCTCTGGCCCGGGAGATGTCGGATCCACGAAGGGATCCAAG
TGGTACGATGTCAGAAGAGGACCTAAAGCAGGAGCCGGATCCACCCCGGGACCAACGAAGAGAGGATCCAGTCTAGATAGAGACGACAGATCAGAACGTG
GAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCATGGAACTAAGGAACAGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGGAAC
GTCAACCTACGGTGATAGTTTATGCCACTGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATGATGGGATCTGTCATCCAGTCACCTTCGTCAGCCG
GACACTGAAGCCGAATGAACTGAACTACGGAGCGGTGGAGAAAGAGATACTCGCGCTCCTGTGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGA
TCCATCCGGATCCTGACTCGACACTCTACGCTAGCCAGGCTGTTCAAGTCAGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTT
GGACGCTGGAGATTGTGAAATGTTCCAAAAGGGGAAGACGGAGATCCTGGGAGTCTTGGCCGCGAGCATCACCTCTCGAGCTAAGATGGGATGAGGGCGC
TGAACTAAGATTGCTCCTAAGAAAGAGCCCAAACGCCGGATCCAGATCCCGATCCCGACGGTACAGGTAAATGAGGATCTGTACGTCCTGAGTTTCGATG
GATCCGCTCGTGTACGACGCGGAGGAGGAGCATACAGTGCAATACTGTGGAGACTTCCCGGATGGGAAGTTGTACGGGCCAGATTCACTTACGCGGAAGG
CCTCACCGTCAATGAAGCGGAGTATAACGGGCTCCTTCTGGGTTTGGATCTACTAAAGGGATAGGATCCGAAAAGACTGGTGATTTGTGGGGATTCAAAT
TTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCTCTAACACTGTTACGGCAGGA