Description :
From Genome Similarity Track
Location :
Scaffold_1645:451- 2506
Sequence
2055 bases(100 bases per row)
TCTCCACTCCAAACATGTTTTTTCGTTGTCGCTACATCGTACATGCTTTTGAATGAAGTTGTGGACTTGCCGATATCGTTGCCTCCCGATaaaagaggct
gaagagctATCCCAAGCTGTACACAATTGTGCTAGTCCTGATGCACTCGCGTCAAATTCTGGTCGAACTAGCGCGTTCCAAGCTACAGAAACGGAGATAA
CATACTTTGCCATTGCATCCATTTTTTTCGAACTTGGTGCTTTACGAGAGCATGGCACAGGTGGAGAACCTCCGAAAGCCGGGGTTAACATTTTCGTACG
GATGACGGCTTCGTAATGATGAACGAGAGGATGGCGCGGGTCCAAGTCAAAGCTGTGCCTAGGTTTGCGCCCTCGATTGCTTTTTGTTCCAATTTCCTTT
TGGTGTGGTACAATATCCACGATACAGGCAAACTCCGAAGGCGAATAATCCACGAAATGAATGCCACGGTACTTATATGATTCTAGCTGACTGACAAAAT
TTGTCTTGCCATCGACCTTAAAAGCCCGcgcgccgcctgcagcaTGTTTCTCATTACAAGAGCGACTGAGGACTGACAAATCTTCTGAGTGGGCAAAATT
CGCTAGTTCCTCGATAGCAGCATCTATCGTTGAGGAACTGCCTGTACCTTTTTTTTTCGAGAAATGCTGCtacatcgtcgtcatccatgCAGTCACTTTC
CGTTGACGAACACGTACTACCCTCCTCAATGTTTGCGTTTTCCTCTGAGGATGTGTCCTGATTtttttccagctcatttATGAATCCGTGCGGAAACACA
TACGTGAACGATTCAGAGGATACATGAGACTTGTGCCCAAGCAAAGCAAATATCATCAAGGAAATAGGCCACTCGTTCGCACCACCGAACGCGTTAACTG
TACGCGTCGCTAGATATTGAGCCTGGCGTTCCGGCGTTTCACTGTCTTCGACAATGCTAGGGTACTTCAGAGCATCTTCGAGGGCTGTGAGCATCACCAC
GGCAGCATTTTTgagtccagcaccttctttTGTCATGTAATTTCACTGATATACATCGACcaaatctccagcatcttctccgttcATAACGCTTGAGTTA
CAATGCGATGCTGTTAAACCAGATAACAAACAATTTGTTTCCACATACATGCCATCGACTTCAGGTCGAAATTGTTCCCAGACAACAGGACCAGAAattc
gaggacgaagaaattCGCCCTGTTGAGAATCGTAgccagcgtccagtttcgTTTCGAAATCTGCGCTGATGGGATTGCCGACGCAAGCTCCATTCACCTT
GTTTATAACCAGCGGCTGGGTTTCTTTTTCGTGAattcctgcaggacgacaAAGCCTACACTGTGTTTTCCCGCGCTTTCCTTTGACGCAGGTCTTCGAG
TGGCAATGAAtgtttgttgcagcagtagaTCGTTGAACCGCGTCTTGAAAACCTGATAGACCTTCACTGATAGGTGGTAATGCAACTTCACATACTCGTG
GGAACGTAGTTCCTGGATTGTTGTACTTCTAATCGTTTACCCAAGATCGTGTAGCAGGGGATAAACGATTCATGCATACAGTATCCATCCAATTTGCGAT
ATACTGACATAGCTCATgacaagaagctccacgCGCCAAGATCTCGGGTGAAAAAGAAGAGCCGTACACTGTCATGTGTAGATGTAATCTTCCATCAATT
TGGGGCTCAACGACACCGTTAAATGCGGCAACTTTTCCATAAGCTCCGGCTTCACGTTCGACATAGTTTCGGCACTTTCTAGTGTCTTCAGAAGCCGGAC
AGCGCAAAATTCCTTTCTGAATCAGATTCATTTTCTACTCAAAGGCTAAAGCAGCCAGAGCAGGGCACAGGTTTGAGATTGACAGACGGAGCCGTGGGCT
GTTTTTAATATCTTCAAGAAGTTCACTCCAGTTGAAGTTTTTTCACCATATACGCAGGTTTCGTCATTCCAAGCGTTATGCTTTCTCAACAACACGATTC
GATGTAAAGTGATATCGTCGTGTTCAGGAGGCGCAACCGTGATCCAAAACAGGGG