Description :
From Genome Similarity Track
Location :
Scaffold_1253:451- 1484
Transcript NameFunction/comments
g16728.t1hypothetical protein

Sequence
1033 bases(100 bases per row)
GTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAACGCCTTGAATCTCGATCTCGACGTAACCCTCGACATGGCC
ACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGATACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAG
TCTGGATAGGAAATTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTG
CCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTC
CGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCC
CGTCCTCGTCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGTCCCGTCATGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTT
CGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCT
CGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCACGTGGAATCTTCATGTAGTCATTTCCCA
GATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTCCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAAC
ACGCATGTTCTCTGTCAGACGCACCTTATGGAAAAGTGGCCACCGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTAGCCGAGCCGCCCTTCACC
ACCGGGAGAATTTGCCTGAAATCTCCCTGAAAC