Description :
From Genome Similarity Track
Location :
contig_21:450976- 452988
Transcript NameFunction/comments
g4624.t1XP_008897794.1 hypothetical protein PPTG_05818 [Phytophthora parasitica INRA-310
g4625.t1hypothetical protein
g4626.t1XP_009522048.1 hypothetical protein PHYSODRAFT_493381 [Phytophthora sojae

Sequence
2012 bases(100 bases per row)
GCGCGTGCGTCACACATGGAGAAGCTCCGCTCCGTGGCTGAGTACTGCGAGGACGACACAACCTGCCGGCGGCAACTATTGATCTCGTACTTCGGCCAAA
CGTTCCATCGCTCCGAGTGCAACCGGACGTGCGACAACTGCCGCCGCACCCAACGCGCCGCCCGCATGAGCCGTTAGCCGCTGCGTTGTTCCAGTACTTT
TAACTAATGTGTCGTTTGTAGGGATGTCCTACGCCCGCGGAATTTCATGAGAGCGAAAGCAAGGATGTCTGTGTTGTGGTTTACCCCCAAGCTGGTTAGT
CGTTCCACTGCTTCTTGCACTGCACGCACTTGTAGAAGGTCGTGGAAGGCTCGTCCGCCGACCGGATCTGGATCTGCATGAAGTACGCCTTGGTGTGTTC
GCAGTGAGGGCAGCGCGCTGCACACACGAAGCACAAGAACAGCCGCAGGTCAGCAATTAACATCCCGCAGCCAATCGCCAGCCAACAACTCTACGCACTC
TCCGTCTGGTCGACGTTCTCCCAGGCTTCGTCTCCGCCTAACACGTCGTCCACCTGCTTGCGCTGCAGTGGCACCTTCTTCTCCACCTTGTCGTTGATCT
GGAAGAGATACGGGCATGTCTGGCAGAAGAAACGCATGCCGTCGGACTGCAATAGGCACAAAGCACAACAGTCAGCAATAGCCCACAGCAGTTGCAGCCA
CACGGCGCACGAACGTCGGGCTCCACGAGCAGGATATTGCCGCAGGATGGACAGAATTGCATTGTTGAGGGCTGGATGAATGGCGAATGAAGGTCGAAAG
CATTTTTGGCATATTGTTGAATTTATTTCCCGTATTTAAGGCATTAATTTAGGGTCCTATCAAAAAACCTAAGTTTAGGGTCGTGTCAAAAAACACCCAC
AGGGCACTTTTTGCCCTAACAAAAAACACCCTGGGTTTTGCATCGGGGGAACCCATTAGGGCTAGGTGGCGAGAGCATCGTGGTACTGCCCAAATATTAT
TTTGGCGGCCGTTTAAATGGCTCGGAAAGTCGGAAAGTAGGCAATTCACACTCCAGTGGAGGATAAGTTGCCCACTTTCCGACTTTCCGAGCCATTTAAA
CAGCAACGTGGAGGATCGGAGGTCGGCTCGACATGTTTATGCACGTAGCTCATTCCCCAAGTCGCGCAGACTCAATTTTTGAAGCAAGTGCAAAATGACC
GAAAGCAAATACGACAGTTGGGGGAGCGGCGCCGAACGCTTCGCCGATGGCTCTCTCTGTCTCGGCATCGACCTGGGCACCACCAACTCCTGTACACTCG
ATCCACCTCTCTATCCTCCTTCTCCTCCCTCAAGACTCCCATCTTCTAACGGTCTGTGCTCGCATTTTTAGGCGTCGGAATGTGGCACGTGGAGCGCAAC
CATGTCAAAATCCTGAAAAACCGCTCGGATCGAGGCCGCACGACGCCCTCCGTGGTGCGATTCGACCCATCGAGTCAAGCCGCAGACGTGGGCAATGCCG
CGGTTGCTTTGGAGACGTGCGAGCCGCTGGGGAACACGATCCGCTCCGTCAAGAGGCTCATGGGGCAGAAATTCGACAGTAAAGCGGCGGACGTGGCCAG
GATCTACGCCGGTTACAGAGTGTTGCCTACAGCCCAGGGGAACGTGGCTGTGCAGGTGCTTAGAGGCGGCAAAAGGGACATTCAGGTGCAGCCGGAGGAA
GTCTCGGCCTGTGTACTGATAGAGCTTAAAGCGTCGGCCGAAGCCTACTTTGAAGACGGCAGGCGGCTAGAGAACGTGGTGATCACGGTGCCAGCGTACT
TTAGCGACTCGCAGAGGAAGGCGACGATCACGAGCGCGTCCATGGCTGGGTTCAAGGCTGTGAGGCTGCTGAACGAACCGACGGCAGCCGCCATGGCGTA
CGGACTGTTCTTGTCAGGCAGGAAGGTGGTGACGGTGTTTGACTTTGGAGGAGGAACGCTGGACGTGTCGTTGTTAAGCATTGATGACGGCAAGTTTGAG
GTGCTGGGAATT