Description :
From Genome Similarity Track
Location :
Scaffold_682:4509- 8121
Sequence
3612 bases(100 bases per row)
CGGCTGGCACTGTGTCGTAGCAACACCCACCTCGCCGTAATTTGCCTCGAGAATGGACACCACCTCCGGGTTCTAAACCGGAGATCGAATATGTAGACGC
GGACGAATTTCAACGCAATCTCAGGACCGGGATGTAACGGATTTTCCCGAATACAAGACCTGTAGGAAATAGAAGTCCGGTCAGGAATTGGTTGGAGTGC
CTGAAAATAGAAGTCATGTATCAAATAAAAGACCGGACATTTATTTTTTTAACCCTTTCGTGAGCAAGTCACTAAGTATACTATACAAACTCAAGGTACT
TGAAAATCAAAGGGGGCATTCTGCTCCGTTCGAGCATGTAGCCATCCCTGCCTCTTGTTGGGTACACAAATGGAACAGGGCAAAATGCCCCCAACGGGCA
GGACAAACCTTGCGTCTTGATAGGCCAAAACAAAATCTTTATGGAGGGTCGCCTCGCTGAAAGGGCGCAAGCCTCACGCGATTGACTGGGGTTGCAGAGG
AAGCGGCACCTTGCTTCGACGGAAGCTGATCTGGAAAGAGTTGGACTACGAATATCTTCGCTATATCTTACGAGGGATGCGCTTGTTTGAAAGTATCCGA
AGGTGTCGTCGTAGGTAGTGCCCCGCGCGCAGTTTTGAAATTCGCGGCTTCGAGTTCACTTTCCATTTTGCGAGCCGCTACCCAGCTCCGTCAACAAACC
TCGCCGACAAGAGGTATGCTGCTGGACCCCGCCACGGACGCCACGCTCGCCGACGGCTAGGGTGGCATGCTGCGGCCCGCCACGCTGACGGCACGGAGAG
CATGCTGCCGAACCCCGACACGGACGCCACGCTCGACGCCAGCACGGACGGCATGCTGCCGGACCCGACGTGGACGCCAGCACTGTCGGCACGCTGCCAG
ACCCCGGCGTTGACGCCACGCTGGACAACTGCACTGTCGGCACACTGCCGGACCCGACGTGGACGCCACGCTGGACAACTGCACTGTCGGCACCCTGCTG
GACCCGACGTGGACGCCACGCTGGACAACTGCACTGTCGGCATGCTACCGGACCCCGACACGGACGCCACGGCAGACGACTGAACGGAGGGCATGCTGCC
GGACCCCGACAAGGACGCCACGCTCGACGGCACGATGGCGGAACCCGGCGTGGACGCCACGCGCGACCACGGCATGGTCGGCGCGTTTGTGTGCCCCGAC
GTGGATGCCACGCTCGGTCGGCACGCTGGGAGGGTATGATGCCGGACCCTGACCTGGACGCCATGCTCGGAGCTGGCAAGGTGGGCACGCTGATCGGACG
CCACGGTTGACGACCGCAAGGGGGGCTTGATGCCGAACCTAGATACAGACGCCACGCTCGACGTTAGCATCGCCAACATCGTGCTTCAGCAATGGCGACA
TGGTGCTTCACTCTTACCAACATGCTTTGGGTCGTGAGAGTGGTAGATTTACTATTGAGCGCAATGGTATTAGGCAAAAATCTGGTAAATGTGAATGAAA
ATGATACGTAGAAGTTTGGATCGTACAAATATTGCTTGCTTGGCACCAGTTCTCTACTGAGTGCCCCCATTGAAGTACATGTATATTCATAGTATCCGAC
GTCGGCACCGTTTCCCACCATGACGCAACACAGCAGTGTTAGTGTACATGACCGAGTGATGTTCAGCAGAAATTCAAGCTTTACAGCACAAATAGTAGTA
GATTTGATATTATATGGATAGGTCATGCCCTGAAAATATCGGCTTGGAGCATGCCCACACGAGCTGCGTGAAGACATGCAAGCTTAGCGGGAGTTGTACC
GTCGGATGGACGGATCGTTGTCGACGTTTGCACAGGCTTGAGCGGCGCAGGAGGTATATCCCCTAACAGGTCAGGTTCGTTCAGTCGATCTCCAACGTAC
GGGCGTTCAGCTCATCGCAGCTGTTGACCAACCGTAGTCCACACTGAGTAGCGTAGACTTCAGGATAAGGGCTCGCTCAAGTTCATCAATGTTACCAATA
GAGCCTGACACGGCAACATCGTGGCCTTCGGTCGCCCCACCTGGCAGAAAGCTTGGACATGTACAACAAGCGCCTTTTACTTGTTTTACATGTACCCACT
ACAACGTGCATGCCAACCTGGCGATCTTTGCGTCGTCCAATCACATGACGGTCTACAGTTCCGCCAATCACGCGCGCACCACGCAGGATTCCGCCAATTA
CGCGACGGCAATGCAGATCTCCGCCAATCACAACACGAAAAAGCCGAAAAAGCGAGCCCAAAGGAAAATAGCCTGGGCTCAGCTTGGCGCATCCTACTTT
AACTTCAACACCAATTAGTACCCGGTCTCGGGGCTCTAGTACTACACGTACTCGTCCTCGGTCTCGGGGCTCTAGTACTGCATGTACTCGGTGTCTGTCT
CGGGCCTCTAGTAGTTGATGTACTCCATGTCTACCTGCAGCTACCGACTGCATCAGATTTGATGCACCAGATTTGTGGTACTTATTGGTAATGTCACGGG
TCCCTAGTACTTTTGTCTCGTGGCTTTAGCATTTCCCGGCACGTCATGGCCCGCGTCTTGGAGTTAGGCATGAGGAGGGCGCCGCCCTTGGGTTCGCGCC
AGTGGGCTGGCGCCAGCAAGGTCACTCAAGAAGCGGGCGAACATGTCGCGACCGAGGTATGAAGCATGAAGATGCCCAGCGGGCTGCGGCAGTGAGCACA
GCGCTCTTGAAGGCCTTGAGAAGCAGTGAAGGCATGGCTGCGGGGGCCAGGGCGAGTAGGGCCGCGGGGGCCAGCGCAGTGGTGGCGCGGCAAGACGTGT
GGTGTGATGTCACTAAAGTAAATTTGTAAATAGTGACACCCGAGAAGCTGCTGTTACCGACCAGTTGCTAATACACATGTACCGACTGTCGATACATAGA
CCTCTTGCCTCAAGACGCCGATAGTAGCTCGAGTGTACGCGGCCGTGGATGTACGCGTCTCGGAGATGTCTGCTCTTAGCTTAGTGCCTCCCACATCGAG
GAACGCATCCTACAGTACTGCTCGATGATCATGAGCAACAGGATATTCATGCTATGACGGAGTTATGTCGTCGTCGTAAGGTATACAAATGTTCATGGGT
AGTTAGTTCATCATGATTAAGCTTAGCGGTTTGCGCTGGTGCGATGATTATTACATTGGCTTGGCCAGTCAGGACCCCTGATCAAAGGAAAATTCTGTTC
ACCAGGCCAGTATAGATTACGTGCAGTCACCGCAGATTTGGCCTTGCGTGTTTAATAGAGGCTAGTCAGGAAACCTTGCAAGGAAGGAGAAAACCTGTTC
ACCGTTGGTAAGTGTGCTGCAGAATATCACGTTGCAATGAGTGGCTATTCAGGAAACCTAATGAGGATAAAACCTGTTCACCTTAAAATTGTTGGCAGTA
TTAGCGTTGCATTCTTTTGATTTAGCAGATAACGTTACTGTTGGTTTGCAGTAGTTTAGCTTTGCTTTTGGTGATGCAGTTGGAATTCATTGCAGTATCA
TGACTACTCAGGAAAATCTAAACTAGGAAAAACCTGTTCGCCGTTCAAGGACATCGTACTCATAAGATAACCATGAAGGTTGAGGAGGTTGTCGTCTCAC
CCGCATATTATG