Description :
From Genome Similarity Track
Location :
Scaffold_1340:4509- 6359
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1340-fgenesh-gene-0.1Carbohydrate-binding family 9

Sequence
1850 bases(100 bases per row)
GCTTGCCCTGGGATTTTCATGTACCGGTTGTTCTGTACCATCACGGCCCACTCGACCCGCGAGAAGTTGATTCGCCAGAAACTCATCGGCTTCGGAGGCA
GCACCGCCGCCGTGTATCGCGCGAGCTCCTTCAGCGGGAGTGCGATTTCCGCGGTCCAAAAGTGCATTTGCTGCGCTGCTCAGCATTTTTCATCAGCATG
ACAACAGCCTTAGTTGGGATGTTTCTACATCATAATGCAGATATCTACCGTTAGATCTTAGCGAGTTTAGAGCAAGGCTAGCTAGTAGATGTACCTGGAT
CATTTGGCGTCCCTTTCATAAACACGGCCGATTTCATGCCATTCCCAAACATGTCAAAGCCATTTTCCGGATCCACGCGGGTGCTGTTCTCATGGCCGCC
GTTACGATACGGACGGTTGAGCAGCAGGTTCCACGTCGTGTTGAGCGCGTTCACCTCAAACTCCTTGTAGTTGTGCGTGCTGCCGTCCGCGTCGACAAAC
ACTTCAAAGTCGTTGTCGGCAAAGACGACGTCGTTCCGCGTGGTCACGTTTGCCCAGACCGCACGCTCCTCCAAGTACGCGCCGATGTAGAGGAACTGAT
CGTCGTAGCGCATCTTGACTTTGGTCGCGAACCAGGGCTGGGACCAGTGCTGGGGGCCCTGGATGTCCACAAAGTCCTCGCTCCACAGCGTTTCCTCCCA
CGCCGTCTCGTTCAGCAGCCCATCAATCGTGATGGCTGCCGGCGCTGCAAAAGCTTCTTTCGAGGCTTTTGTGCCAGCACTGCCGCCGCCGTTTTTGCTG
CTGGCTTGCGCTTGCAGGTGGTAGACGGCGTAGCGTCTTGGATGGGAGCTACGAAAGTCGCATTGCGCAGTTGCTGAGTATGACATCAGCAGGACTTGCA
GAACAGCCACGAGAAGCGCATTGCGCAGAGGAGAAGAGAAGGACGAAGCTGCGGCGGCTGAGGCGACACGCATCGCTCACTCTTCTTGTTGATCTTCGCC
TGTGAGCCACAAACGTAAGCAAAGCAACTCTCTTCTCAACTGTCTTCGTTGCTGATGTTGATTTTGCCAGTGGCTTTTGGCAATTGGAACGGGGTGGGAA
GGATGTCCCGCAAAACTATTCACCACTAAAAACCAGTATAATGGTTTATATGTGAAGATACCTGGCGTAATATTGTGAGGCATACTGTGATATTTCCATG
TTGTCTTATGTTGCTGGGTCGGATGATGTGCAACATAGTCAAGCAACCACTTCACTTCAACCTGATCATTCATGAAGTGCAAAACGTGCAAACTGGTTCA
GTACAAATTGTGAATGAGCAGTGTGGATTTTCGCTCGGCTTTCATATTTGGGATTCTGTGCTGTTAAGCATGAGCAGCGAGCGATCTCATAGAGCAACAG
CACACACGTTCACAATCTGCTTGGAACGCTACCCTGTCACTACACGTGAGCGATAGTACCTCTGCCCTTGCTGGCGCCTCGGGAAGTATCTCCTTCACAT
CTGCACGCCTGGAGCTCCTCATTCTATATAAAGAGTTCTTTATGCATGCTTGTCGTAGTCGAACCGATTCTGGTGTTTGACGCTCCGATATCTCTTTTCA
GCCCATCAGCATTGTGTCCTTTGGGTGGAGAAATGTCGGAGGATAGTGACGAGGAGGAGAGAGGAAAAACGAACGGCGAGATGCTTTACTGCTCCAGTGC
CGCAGCCCAACACTACCAGCAACAGCAGTGAATGACAGATGAGTAACTTCAAACCCGGCGCGTGACGCGACTGCTCTGGTTTCTCAGTTTCGAGGGCTCT
CGGCTGCGGAGGAATGCCCTCAAACTAGTTACAGTACTCACTCGATCGTT