Description :
From Genome Similarity Track
Location :
Scaffold_1188:4508- 5962
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_1188-fgenesh-gene-0.0Amino Acid/Auxin Permease (AAAP) Family

Sequence
1454 bases(100 bases per row)
TCGACGTTCTTCTCAGCCGAAGACGCCAAGACTGCCTTCAACATGGTGTGCTGCGTCTGCGGCATCGGCTCGCTCGGCATGCCGTCCAACTACTCTCGCG
CGGGACCATTCTACGCCACGATCGCACTGCTCTTCATGGCGTTCGCCAACATCTACGCTACCGTCGCGCTCTCCAAGGTGATGCTGGCGGCGCCGTCCTC
GGTCAAGACGTACAGCGATCTGGGTCGCTGGGCCATGGGAAAGTGGGGCTACTACCTGGTCGTCATCTCGCACATGGGCGTGTGTCTACTGACGCCATGC
GCATTCCTGGTGCTCGGCGGACAACTGCTTGATGTACTCTTCCCGGACGCCTTCAGTCAAGCCTTCTGGATCGGCTTCATGGCAGCCGTGGTCATCCCGA
TTGCCCTCGTTCCAACGCTCAAAGAGAGCTCCAAGCTCGCGCTCGCCGGGTGTATCGGCACCTTCGTGGCCGATATCATCGCTGTCTCCATCCTCAACTA
CGAGTTGCGTGGCTACCCAACTCCGCCGTCCCCCGACGTGTCTGTACATCAGGTGCTCATGAGCTTCGGCAACCTCTCGCTCGCCTACGCTGCAGCAATC
GTGGTGCCAGATCTCCAGCGTCAGCACTCGAAACCGAACCGGATGCCGCGAGTGATCTTCCTCAGCCTGCTGCTCGTCTCGGCGTTCTTCTTGGCGCTGG
CGATCGCAGGCTACGTGGCCGGCGGGTGTCAGCTGTCCGGAAACATCCTCTTCTCGATTGTGTCACCCAGCGAACCGCTCTCGGCATCGACCTTGGGCTT
CACGGCTTCGCGCGGCGCCGTCATCATGGCGTATCTATTCATGCAGCTCCACATCACCATCGCCTTCTCCACGCTGCTGCAGCCAGCCTTCTACATGGCC
GAGCGAGTCTTCCTGGGCATGCACCAAGAGTCGTCGGAGGTTGGGAACTGCGACTGCTCGACCGACGAACTGCAAGACAAGGTCCCGTACAACTTGGTGT
CGACGCCATCCACGGCCTCAGATACAGCTGCATCCGACCTAGAGAGCGACAGTGAGCATTCGGCTCCCGTCAGCATCGAAAAGGGAGACGACGCATCGAC
TGAGTACCAGGACGGACCCAACAGCAGCCGCTACGCTCTGGTGCGAGTCGCGATGATCGTGACACTAGCTGCCGTCTCGATCGCTTTGCGTGACCACTTC
CTCGACCTCGTGGACTTCACCGGAGCGACCTTCATCACCACCTGCTGTCTCATCGTGCCGCTGGTGCTCTATTTGAAGGTGCTGTGGCTCAAGCTGCCGT
GGTGGGAGCGGTCATTCGCGCTGGTGATCATTGCGATCTGCTCCGTCGCAGGCGTGTACGTCATGATCTTCGCTGGCAAGAACCTCATCCGGCCGGACGA
GGACTCGGCGACGTTTCCCTACTGCTCCGAGCGGTATCAGTCCGAGCCGTACTA