Description :
From Genome Similarity Track
Location :
Scaffold_16:450795- 459031
Transcript NameFunction/comments
Phyin_T30-4PITG_08707Putative uncharacterized protein
Phyin_T30-4PITG_08708Putative uncharacterized protein
Phyin_T30-4PITG_08709Putative uncharacterized protein

Sequence
8236 bases(100 bases per row)
CAATACATGTATTAATAGCTGGGACTGGGACTCTGGATGGAAGCTAGATGCTGTATCAGCCCTCTTTCCAACTCGATGTCGTCGTCAGCGTCTTCCGACA
ATTTCTTTTCCTTGTCTTGCTTGTCCTTCATTTCAACTCCAGGAACGACGTGGTCCGAACAGCAGCGCTCGATGAATGTTTTCCAATTCTTAAAGGAGCT
GACGCGACGAGGTGTGCGACGCTTGCTGCTCTTCTTCGGTGTGCTGTCACCGATTGAGACTAGAAAATTTTCGCTCGTTCCGGAGCGACGACGAGGCAGC
AACACGAGCTTGTACTCAAACGATCGAGCCCGACGAGGAAGGCTGCAGCGTACTTGAAACCAGTACGCTGCGAGCACTACAAGCCCGGCAACAGAAATGA
TCCCCATCATAATAACCAAAGAAGCTAAAGTCGACCCAGGTGAAATGTTTGTGCTCTTCGATAGAGATGCCGACTCCATTATAATCTCGGTTGATAAACG
AGCTGTTGTGGACGCATTCATCGGCGCTTCGAGTCTTACTGCAAACGCCCGCTGCGCTAGTGTACCCGAGTCTGCTAGAGCTGGGAGGACCTCCACTGCA
AGCTGCGCACGTTGTTGTCCCGCTTCGAATAGCACCACACCACGCGACTCGACAAAAGCTACACCTGCTTGAGCCGGATGGATACTTGTACTCGTTAGAG
CGGTAAAATACGTGACGCGAGCACTGGAGTCGCATGACCGAGAGCAACACTCACGCCGTAAAGGAATCACGACTAGCAGTCGACGTGCAGGAGGCTGCTG
CACCACAAGAGGGGTATTGGAGAAAAACGCAAACGAATCTAGGCACGCCTGGGCGTCGGCGCTCATGCCCTACCGACACAAAAGCAGAATCAGGTTCTGA
AAGTCGTCGCAAGATTGTGTTCATCTACAGGGAAGAATGTGGAAGACGACTGCTGTTTACTCGTGCTAAGGGTCTGAGGAAACAGGGAAGCGTGTCTTTA
AAGCGTACTTATAGGTATCGATCGCCTGCTAAATCTAGCGGTAGGAAGATCAGAACGTGGTGGACGGAGCCGTCAAGAAGGACATGGACTAATGTACATG
TAAGCAGTCTATATTTGTGCGTGGACTCCTGGCTGACATCTTGGCGTGGTCAGGGACTAAGTGGGTCAAACTAGTCAAACCAGCGGTCGGAGTTCTTGGT
GCTATCGTCCCCCTTTGCCACCACAGGCTTCTCACCAAAAATCTTCTTCTTGTAGCTACGCACCATCTCGTCGAACGATTTCTCCTTCTCCAACTCCTTC
GCGTGCTTTCGCTGACTACGAGACAACGTCTTGCCTTTCTTGGCCATGTGAGCGGTCTCAAGAGAGGCCAAAGCGTCATCTGCAGCATCACCGCGCGGAG
GCTCAACACGTTTCCGCTTCTTGAGCTGCTGCTTCACCACCTTTTCAACCTTCGCTGTCTTCTTGGACTTCTGTGTCTTGCCCTGATCCGTCTCCGCCTT
TGCTTCGGCCTTCGCCTGTGAGCGCAGTTTCTTCTTCTCGCGCTGACGCTGTCCACGGCTCTTCTTGGCTTTTTCAGCGTCGTCACCGTCCTCGCCCTGT
GCTTCCTGCAACGCACGCTCCTCCTCGCGCTTCTTAGCAGCGTCGGCAGCTCGCTTTTCACGCAGCTTAAGTTTCCCGTGGTTCTCCAGAGCAAACTCCA
CAATGAGACGTGATTTTGTGCTGTCAGGAGCTCCAGAAGCAGGCCCTCGGCCAGCAGCGTACGACGTGTACTTGGGGTTGTTGTTGAGGATACGCAGAGC
GGCCAGAGCGTGCAAATGCTCGGAAAACTCCACAAAGCCGTAGCCACGCGAACGCGGATCTTTTCCAGCCTTGGCAGACTCCATGTCACGCACCACCTTG
GCCATACGGACTTTGACCGGAGGGTTCCCCTTCGGAAGCAACTCTGGTTTAATCTCGGTGCGATCCACGTTACCAGCACAAACGCCAGCACTTGCTGCGT
CATGAAAAAGCTTCTTGAGCTTACGGTCGTCCAGCGCAGTCGACAAGTTACGAACAGAGAGACGCATGGGCGACACGAAGTACATGGGGTTCTGGAGCTT
CAGCTTCTTCTCGCGGATGGCGCGACGACGCTTGTCAATGTCCATCTTTGGCAGCTCCAGCTCGGCATCTGCCATCTTGTTGACGTTAAGCGTGCCTTCG
TATGCCAGATACAAGTTACGCTTGTCCAAACGACGACGTTCACGGGCATTGGAGTCAGCCAAATGCTCAGCGTCCGTCTTGGACACAGCACGGGACAGAA
GAAGCTGACGGCCGTCCAGAGTCAAGGCATCATCGCCACCGGCCGCCAACGCAGACAGCGTGAACACCTTATCCTTCTTCTTCTTATCCTTCTTGTGCTT
CTTCTTCTCGTCACCTTGCGGTTGCTCCCCACGCTTCAGAACTTCTGCAGCCACGTCAGCCGATTTAAAGCGAACGAAGCCAACGCCCTTGGACAGCCCG
GAGCCCTTCTCGTACACTACACGGGCATACTCGACAGCACCGAAAGCCTGAAAGAATTCGCGCAGTCCGTCCTCTGACGTCTGGAAGGACAGATTGCGGA
TAAACAGTGTGCGATCACGTTGGGCCTCTGTGTCCTCCCTGGGAGCAGAAGCAGCTTCCTCCTCCTCCTCCTCCTCTCCATCCTCTTCGTCCGAGTCTTC
AGATCCAGCGCCAGCCTCACCGTCCGTAGCCATTTCGAGCTGATCTTCATCTTCGTCTCCGCTATTAGCCTCTTCGTCCTCCTCGTCTCCTTCCGTAGCA
GCCACTGCCTCCTCCTCGTGTTTCTTCTGCTGTTCAAGATACTTGGTTTTGGACAGCGCAAAGTCGACAATCATCTCTCTGCCCTTGAGTTTCGTTCCAT
TGAGTTTCTCCACAGCTGCACGAGCGTCAGCCACATCACGGTATTGCACAAAACCGAAGCCACGACTGCGACCAAGTACCGGCTCAGCGTTCGTCTCTCC
ATCGGCCTCCTCGCTCTCCTTCGTGTCCTCTTCCACGGGCATACGCACGACGCGAACCTCGAACAGCGGACCATGCACCTCGAAGAGCTTCTCCAGGTCC
GTGTCAGTGGTCTGGAACGCCAAGTTGCGTACTATAAGACGCAATCCCTCAGTCTCGACAGCTCGCTTCGGGAGACCAGGCTTGCCAGCAGCTTCCTTAT
CATCGACCACCACGGCCTTCGCGGCAATCTTGACCTGCAGCACGGATCCCTTGAAGATGTGGTGATCCAACTTTGCAACAGCCAGAGCTGCGTCCTTCGT
CGTTTTAAACTGCACCAAGGCGTACGTCTTGCCGGTGCGAGTCTCCTCCTTCAGTTCAACCTTCGCTACAGCGCCAACCTTCTTGACTTTTTTAAGCACA
TGCTTTTGGGTCACATCAGCGCCCAGACCGAAGACCAGGACCGACTTTTGCTCCACACTGGCCTCTTCCTCCTTACGACGCTCCACATCGCGCAAGAACT
CGCGGTGCTGACGACGACGCGCGTTTCGCTCACTCTGTACGTGGCTAGAAGAAGCAGCAGAGTCAGCAGCGGGAGCGGCAGGCGAGAGCTCAACCTTGGG
TTCCTGTTTGGGTTCAGTCTTCTCTTCCAGTTCAGCTGCGATCGGTATCTCCTCGGTCTCTTTCTTAGCTTTGGCCTCTGCTTTCGCTGCTTTCTGGGCA
GCCTTAGCAGCGCGACGCGCTTCTTTCGCAGCCTTCCGCTCCTGCGTGGCCTTCTCAACCTCGTCTGGCAGTGCAGGTTGCCCCATCGGTACATCCTCCT
GTTCTTTCTCGTCCTGCTTGGGTTCATCAGTAGCAGGTTTCTCCTTTCCAGGCAGTCCACGACGCTTTCCCTTCTCCATAGCATAGTCTATCAAAGCATT
GAAATGGTCAGTCAATGCTTTCAGGTCTTTATTAAGCCTAGCAAGCACACCGATGAGCATCTTGCGTCCCTGGAAGTCCGTTTTGTTAAGTTTCTCGACG
GCCACCGCTGCATCGCTCTCCACGGCACTGCGGTATCCGTAGCATGAGTGTTAATGTTGCCAATGTTCTCGCCATTACCAACTGAAGACGTACAACTTCA
CGAAGGCGAATCCGCGCGTGAGCATCTCGCTCTTGCGTTTGCCCTTATCCTTGATGACATCGATCTTCCTAACGGGGCCGATTTCGCTGAACACGTGCTC
CAGTTCCTCCTGCGTCACGCCAAACGGCAGATTGCGCACAAATACGCTCGCCATCCTGCTCCACTGGCCAATGCCGCAATGGCTCTTCACAACCAGTGGC
CATCAATATCGGATTTAACAGTTTTTACATAGATATCTGAAAGGTAGAGGTAATCATATTATACAAGAATTTTCAAGCCATTGAATTGAAGAGCGTTTTA
CGAAGCCTCAAATATTAATGGTGCATGTCAAGGAACACACAGTGTCAATGAAAGTTTGCTATGTATTGGCCTGACAGGCTCTAAATAGTCGTTTACCAGA
CGCGTCAGCAGCGCTGGAAGAACTTGAAGAAAGGAAGGACAGTCTGGTCTACTCGGCAGCTGGTTTGTAGGTCGAGGACGCGACGCCCAGGATGGCCGCC
ATCTCGACTGCGCCGTAGTTCTTGGCGTCCTTGTTGGACTGACGCTTGCGGTAGTGCAGCCGTCTCGAGACAGTGGCCTTTTCGCCGCTAGCTTTTTTGC
TCTTCTTAGCCTTCTTCTCCTTTTTAACTTTCTTCTCTTTTTTGATCTTCTTCTCCTTCTTGGTCTTTTTAGCCTTTTTGCTGCTGCTGCTGTTGGATCC
CTCGTCCGAACTGTCTGCATCCGAGCTCGACTTACTGCCGTACGACTTGTTGAGCGTCTTGAGCACGTCCGCGAAGCCACCAGCCGTCTGCGACCAGCCC
TGGACTTCCGCCTGCTTGAGACTGCAGCCCACGCCCAAATTTTCCGAGCGGCGTGCAATCTTGACGTGCGTGGCCTGACCCTGTAGTTCCTTACCCACAC
CCTTCCCGGCCGACCAGCCCATCTTGACCAGCATCTTGAAACCAAACTTGGAAGTGTCCGAGGCCCACGCCATGTTTTGCATGCCGCCCACGGCCACCAT
CGTCCTGCCGGCGTCGTCGGTCTCGACAGGAGAGGAGGAGGAAGCCACGTCCACGGCCGACATCGTCAGCTACAGATATACTATTGGGAAGACCACGGCG
ATCAAAAGGAACAACCAATGACACCGCCCCAGACTATCGCAGACTATCGCTCGCCATTCAACCAGCCGACGTCGTACTTAAGCGACCTCCGCATGGATCA
AGTACTAATATCGGTACTGAAATGAAGTACCGGTTTTTCTCAGTTAAAAGGCTGAAAAGCTAAGAAGTTGAGTTTTCCTCCAATCACGGATCGCGAAGAA
TAATTCAGGTACAGCTGAGAAATATCTGCATGTGCAAAACAAGATAGGGGACTCTCGAATAGAAAATACCTTGTTTTGAATTTGGCCCCAGTCTCGTCTG
CCCCCCAATTCCCGGTTACCAAAGTGGGAATTACTGGGCTTTCACAGGAAATCGGTATTCACCATTTTGGTACCGATAACCTGCTTACTTTAACCAAGAC
AAAGCACCACTACTTCGCAGCATCTATGCGACTACTGCCAAGGTACCAGTACAAAAAAAAGTTCAATTCCCAATCAATTCCCACTTAAATCCCACTCAAT
TCCCAGCAGGTCCCGGTGGGATTCCCTGAGAGTATGCTATCCCTGTCACCACCCCAGAGTGCTGTGTCAGCACACAACAAATCGTTGAGTTTGATCAATT
GTTTATTTTCTGTATCGGTGCACAAACAGGGAAGCCAACAACTAAGCTATCCAATCACGTCGTTTGCCGTGAGGTCGTCATTCAGTGCACACTATCTTAA
TTTACCCAATCATAAACACCATGATGCAGCTGAAAACAGTTTATCTTAGCCAACAGCACCTCTAAACCCAGCTTGTTGCACCGGCTGATTTTGTGAATCT
ACGAGAAGGACGCTATTCTCGACGTTCCGCCCGAGGAGAGATGCCAAAGCGTATCCCTTGGCGGGATGCGGCCCTGAACGTTAGCGAAACTGACGCGGAC
GTGGTGCCCGACGGCTTAAAGGCCTTCGACATCACCAAGATCAACAGCATAGCGTGCACTATATGCTACGACTCTGAGCATAAAATGCGGTACAGACTAT
TGGGGATGCGCGTGTGAGGCGTTTGCTGAGGCCGGCGAGGTCATCTCGGTGAAATATTCGTGGCGGGGCAAGGTGGTGACATGCAGCGAGACTAATGCTG
CGTGCATCTACGAGTTTGGCGAGCATTTGACTACCGCTGAGGTTACAAAACGCAAAAAAATTAACGGAAACGCAGAAACGTTTCTACCGTGATATGGCCA
ATAAGCACCTACGACCGATGCGTTTCCGCATTGCGCTGTCACGCAAGTTCAGCACACCGCTAGACGACATGTCTTCCCTCTCAACGGTGCAAAACTTTGT
AAACCACTATTCCAGAACCTACTTGGAGAATCACGATCGTCTCAAGGAGCTGACGGCGTGGATTCATGCTCATGTCTTCAATGGCTCCTAGCAAATGCCT
CAATCATTTGTGTTCGGTTGGAACTACGACTGTGACGGAAGACTAGTGGTTGGAGATGGATCAGGTGAAAAACCATTTATTATAGGGCTTACAACTAATG
CTCTACTACTGCGGATGATGCTTCCTCTTGAGAGCTTTGTGCTACACGTCGACGCTACCTACAAGATGAGCCACGTGGACTACCCTGTCGTTGTAGTTGG
AGTGTCCGATCGCTCTCGGCGCTTCCACCTAGTCGCGATCTTCATTGTGTCCCAAGAGACGCAGGTTGTGTACGAGTCTGCGCTACTAGCCATGCGCAGG
CTCTATTCGGGGGTTACTGGCGAGGAATAGGTAGTGCAATACGCAATGGCAGACGGAGCCAAGGCACAACACAACGCTTTATACACGACTTTTGGATTTA
AACCAAGATTTCGATTTCTTATGTGCTTTTTCCGCGTGATGGAAAAAGTTCAGAGCGTGATCAAGTCATTTTCATCGCATCTAGCTGTAAGTGTAGAGCA
AGATATCTATGATCTTCACTTCGCACGGACCGAACAATAATTTTGTGAAAGAGGGACTCAATTTTGGAGACGTGGGAAAACGACCCGCGACTTTATCTCT
TTTCTCAGTACATGAACGCTCAATGGCTACAAGGACCCTTCAGTACATGGCAAGCGTATGCTACTTCCAGTGGCTTCGCTACTACGAATAATCCTGCAGA
GACGTTCAATGCAGTGCTCAAGAGAGACTACACGTTGCACCGCCGCCTTAAATGGGGACTCTACTAAGGGAATTGAGTGCATGCTGCCAAGAGTAGTCCG
CCAGTGCAAGGGCATTCGCGTTCGGTGTCATTCCAGCGCAAACACTCACACGCAGGGTGTCCGAGCTGGAACGCTCTCGCCTATTGTCTACTGTTGATGC
GAATGGAAATGAATCTGACTGTGCTGGACCCCCGGAGATCGTCCGGGTGAAGGCGTTGCTTGCTCCACCTGCAGTGATGGCTCCTAATAAAAGAAGTGAG
GAGGATATCGCTGTTTCCGCTCAAATGGGCGTGGATTACGCTAGGATGGAGACATTATATCAACCGGACGGTGATTGGAACGTTGCTGTTGAGAGGCAGT
GGTGTCCCTGCCACTACTGCTTTGTGTTTGGCACTTGCTTGCATGTGATGTACGCAATGCGAGTGACGGCGAGTGTGGATAGCCAAGGGCGTAACATTTT
GGTTAGCAGAAAGAAGCGCAAACGCAAGGATGGCGACTCCGAGGCTGCTGGTCAACCTCGGAGTGCAGGTCCCGCACTCACTTTTGAGTGATCTAGCACC
AGGGTTTCTCAGTGTTAGTGTCGTATTCTGGTAGGAGTTAATTCAGTTTAACTTAGGTAACATGAGTCATTCGAGCATTTTACTTTAACAGTCCTGAATG
TTTCATATCTAACGTTTTGAAGATGTTGGTAAATGCATTGAAGAGCATACTTGTACTTTATGGTCTAATAATGAGAAAAAATCATTTTTCAATATTCCTC
GCACGAACGGAGGCCACGACACTTGATTCCAGTGTTTGCTCAAATTAACAATGACAATTGTATCGTTTCGATCGTCTTGGAAAAGGTCGAAAATGGAAAC
TGTTAATACCTCGGCACTGAGCTGTTCAGCACCTCT