Description :
From Genome Similarity Track
Location :
scaffold_70:45074- 47008
Sequence
1934 bases(100 bases per row)
AGTCTTTGCGAATTGTTACCCAATCAAGACGAAATCATCAAAAGCATTAAGATTGTTGGCATTACTAGATTCTGGGCCCGCGATCCGAATTTGACGGGCG
ATAAAGAATGAGATGATGCAAATTCATGGCATATCAATGCTTATCTTCTGTCATTGGACGCGTCTGTTAACTAAGCAATAGTTTTGCTTGTTGAGGAAAA
GGATTTCAAACCGGACTCGACGGTGATGAAcctaaaaatattatttcttTCAAACTATATGAAAGGATCCTATACGTAGTGGGTTGATAAACCGTTTAAA
TTTTGTACCTGGAAATGAAAAATTTACTCTGACAACGAGAGCTGTTCAGAAATTCCCACAGACGTAATCTTTTGTTTAAATGATACTTCAGTTAACGTAG
TAGTCTACAGTGTCTTTTAGAGTGTTAACGATGATATTCCACTGGTGCTCGACAATACCAATGCTTTTGAGTCTGAAGTTGTACCATCGGTGTGTTAGTA
TGAAGTTACGTTATTGCTGTCCCAATGTATGTCAAACTGAAGAAAGCGGTGCGATAAATTATTACAAGAGCCAATACTTGCGTTGCTGTGTCAGCCGTGA
GACCAGCCACGTATAATCAGAGAGAGTAGTCATATGTTAATAGCATCTATTGATAAGTAAAAAGCTGGATATGCATAGGTGATGAAAAACTGATTGTGGG
TATGAAAAATCAGAACTCATTTCGTCAGACGCTACATAGATTCGACAATCAAGGAATGCATAGAATTTACACAATCGCAATCTGTACATCATTAGGCGGT
ATCTCACATTTCGGTGTTTTACTGCGAAGAAACTCTTACGAACCAGCATCAATGGCGATGTCTCGGCACTGATTTATGGAGTATTGTTCGGGATGATCGT
TTTCAGCCTATCATTCGGAGTGAAAAGCCACCTTTGCCTTACATGTATGCACTTGCCTTGATTGCTCCTATGTGTAGTCAAGTATGTTCGTGATGAAAGC
TTTCGCTCGGCATCTCGGTCGAATAAAATTAAGAATCGAACGATCGCTCATCAACACCAAAATTGCTAAAAATCTGTCACAATCAGAGCGAAGTTTAGCT
TTCAATATTGCTATTCAGGTCTCTCCCTAGCAACTTAGCTACGGCTTAGAAATCaaattcttgtttaagtgtctGCGTATAGTGGCAAAGCAGATTTTTA
TTTGTCGTTTCTGTGATGACTTTAACTATAAGTTCCAGTTTACTAGGATAAGCGGAGTCTCTCGAAGTGATCAACACACAGGGACAATTGCGATGCACCT
GACGAGTAATTATAAATCAACAACAGTCTTGATCTATTTGATATACCGTCGTTTGTATAACTTGACAGGTTTAAAACGGATACAATATAATTCCACGCGA
ATACTTCTTCCCCAGACTCAAAGGATTTTACTTATGCTGATCAATCTCTCTATTAACAGCAGTGAGTACAACATCGACCTTTGACCAAGTGCTGCTGCTA
CAACTTCCACTATTCATCGATATAACGATGTGTTTTAACTTCAGCTGATTGTAAACAGTATTTATTAAGCGGGACACCGCAACAAGGCCAGCTGCAGATT
ATATTCGTCCTGTGGCTGGATGGTGTTTTGGGCTTACCTACTTTAGCTTGGAGATCACATACACATCATATTCGGAAAAGCTGTTGATCTGACGAGCGGT
AAATGTCCTGCTTCTTCTGCTAACTGTTGCAAGTGCTTTAGAAGTGGCACAGTATAAGCTGTACAATGCATTGTATTAGCGATATGAGCACAAGGAATAT
CGCACCTGTAGTCTATATGGGCACTGAAGGGATGAAGTACATGGCAGCACAGGCTCAGTGGCACGTGTATACCCGATAGATCAGATGACATTCCCTACCA
GAATTTGGTGCCTTCCATGTTAATTCATTGCAGA