Description :
From Genome Similarity Track
Location :
Scaffold_90:450718- 452003
Sequence
1285 bases(100 bases per row)
TTGTAACCGTCAGCGGATTCTTTCCGCAGACGCGAGTAATCAACCCCGGCTTAATTACAGTCCGCTTTGTCGTGCAGCCCAGCTGCATGCGAGCACGCAA
GCGTTTTCAGAGCTGGACGTTTGCAACCGCCAATACTACTTGCCGCATCGTCAGATCTCGGGGCTGACGCGCTGTCATCACCGCGACGCCTTTCGGCGGA
GCCCTTCGTGATTTTCGAACCAATCACAACCGTGTCAACTCCCGGGACTGACACGTCGACATACCAGCTACTGTTTGTAGCTGGCGTCCCTTGAATATCT
GACGCGTCAGTCCCCGGGACCGACGCACCACCGTCACAGCCACTGTCTGTGACTTGAAGTTCTTCCATACTTAATCGATCAACTCCCCGATTTGATACGG
CCATTGAATTAGGACCGTGTCTCAAATCTGATTTCCGATTTAAGGCAGACTCAACGACTGCCTCAGTCGTTGCGACTTGTGCACGGGCACCGGAGGCTGC
AACGTAAGATGCTGCCTCGACGATAGGGTTGAATGCACCCTGCGGTGCATGCGCGACACTGACAGGGCCATCGCTCTCTGTCGCGTTGTGTCCGAAGTGT
ACAAGTGTACACTTCTCCCATTTGATCACTGGATCATACCGTACAAGCCACGACGTGCCCAATACCAAGTCAAACTTATCTTCCAGATCCAGGGCGATAA
GATCTTTCACAAACACCCGGTGTTTGTTCGAGAAGCGCACGCGTACTACGCGCTTCTCCGTTCTAACGGTGGCACCTGCTGCCAACCGCACCTCCAAAAC
ACTTCGAGGTGCGTTAACTTCCTCGAAGTTTAGCTTTGGGAGACTTTCCAGTCGAGCGAAAATGCTTGACACACCTGAGTCAACCAAAGCACGAAGAGAG
CCTGCTCTCTTCGACGTCACCTTCAGGATGACAAGATTTGGTTGCCATCTTGCTTCTTGCAGCAAGAATCCCTCTCGCTGGGGGCTGTTGTTCTCAACGT
CGCGTGTCCGTTGTAGACACACGTGCCTGCAATACCAGAAGGGCGCCCCGCGCCTACTGGCTCTGCAGGTTGTGTTTTGTACGCGGCAATGCCCGGCATC
GCCACTTTGGTCCCTTGCCGAGTGCACTGGCGCTGTGCACTCACGCGCAAAGTGTCCGGTGTACCCACATCAGTAACACCGCACTTTTCCTGTTGGCGTC
CAACCGCAGAAGTATTCAAGAGGTCCATAGGCTCTGGACCTCCCGCTCTCATTATCGGACGTGCCAACCTCGATACGTTCGTGTG