Description :
From Genome Similarity Track
Location :
Scaffold_546:4507- 6236
Transcript NameFunction/comments
Phypl_g9301hypothetical protein PHYSODRAFT_488439
Phypl_g9302hypothetical protein PHYSODRAFT_285661
Phypl_g9303ATP-binding Cassette (ABC) superfamily

Sequence
1729 bases(100 bases per row)
AGCTTGTCGGTAGACGCCGCTGCGGCAGTGGCGAACACCCGCCAGACCATGTGGCTAGGCAAGATAGGAAGACTGCGGCTTGATGAAATGGACGGGTTTG
TCCGTGCGGGCCTGCAGCACTCCCGAGAGTTGATGCGGCGCAAAGCCCAAGTGGGCGCGAACATTCGAGCGCGGACGGCAGGACCGTAAGATGTGGCGTT
CAGACATCATACTGGAAGgagcgatggagacgaagacgaggaggatcTCTCGGTGGTAGCTTGCTCTTTTACGAGTGCGGGCGCGGGGACCTGCGTCGAA
GTCGAGCGCTTCAGAATAGCATCAAGGACATTGCCGCTGGGGGTTTCGCCGCGCTCTCCACCTCACGCTCGCCGCTAAAGTTCGTTCGCAGTCTCTGCTG
TGGCAAGCTTGGACTTGAACACGCAGCGCAGGTTAACTCTGACCTGTCCGTTGACGTTGAGGTGAACACCCGATCTGACAGGCCCTCTATGAATAGATAT
CAGTTCGAAGAGGAGGTCAGGCACTCCATCAGCGGAACCCTCAAACTCATTCGCGAATCAGCCGCCTTCCAGACTCAACTAACGTCTACTATCGCCATGT
GCATCAAGGTCGAGTGCCCCACCTGCCGCAAGCCCACGTGGAACGGCTGCGGCCAGCACAtcgacgccgcgctctccagcgtcaaggaggaggaccgCTG
CCCGCAGTGGAAGACCGGCAAGCACTAAGGCAAGCGCCCAGCCCACCCCAGCAGCCACGCCGACCGACGCCTTTGAGCAGATAGGAATAGGATCAGAGAT
GTCGGCGGCCATTGGCATTAACGCCCACCCAACCCTTAAATCAAGTGAGAGCATCCTCATCCATTGATGGTTCACTGTCCTAGCTTCTTATCGCTTTGGC
TGTCGGGCCGGCATCTTCCTCATCGCCCTAGTGTCCACAGTACGATCGTATTACTCTCCGTTGAGACGTCCAGCCTACGTACGTTCGGGATCTCTTGACA
AACCGAGTCACGCTGTTCAAAAGAGGCGATCACCTTTAATTACTATACAAAGCACTATGGATAGTAGTGATCCATGACGTCGTATCAAACAGGAAGTGCA
TGCCAAATTCGTTTTCTTTTTGGTGATAATCCTGCTGGACGGACCGCTGTTGGGAATACAGCACTGCGCGGTTCATCTCTGCGGGTCGCTCGCTTGCCTC
AGACAGCGCTACACGGCCGGCCTCTctcttcatcgccgccgtcgctgccaccagcttcttcgcgtttGCATAGCTCTTCATGCACTCACTACATACCGAC
TTGTTCGTCTATCTACAATGTTCAGGAGCCTGGTCCAGTCGTCGTCTACATCTTGTATACAATAGGCGACGTCTGCAGTCCGCGAGTCTCTGCAGGCTCA
CGCACCGAAGCTGGTTGTTTCGTGGGCGAAGTAGGCTCGTCCGCAACGGAGAAACTGGACGATTCCGACACAacgggcagcgccgcctccatctcTCTGC
TGTAGCTCCTTAGAACCCTGGACGCGCGCTTGGACCTCGGTTTGCCGAAGTCcacgcacttcaacttcatgaccggcgacggcgtgcaCATGTTGAACGA
GGACGTCCGTCCACCGCCGCTGCCAGGCGCAACGcccagcctcctccttgctccACTGCCACTACCTGTCGACAAGAACTTGTGCTCCTTGGCGGCCAGC
TTGACACCTGACCCAGACCTGGGCTTCTT