Description :
From Genome Similarity Track
Location :
contig_32:450677- 453045
Transcript NameFunction/comments
g6247.t1conserved hypothetical protein
g6248.t1hypothetical protein PHYSODRAFT_484729

Sequence
2368 bases(100 bases per row)
AGCACCCGCGAGTGGATGGAGACGCCTAGCGTGGTGCTGGACGAGGCGCGACTGCAACACAACATCGAGCGCATGCAGGCGTTGGCGACGTCGCACAGCG
TGAATCTCCGTCCCCACGCCAAGACGCACAAGACACGGGAGATCGCGGTGAAGCAATTGGCGGCAGGTGCAAGTGGCCTCACTGTCTCCAAACCGTCTGA
AGCGCTGCGGTTTTTGCGCGGGGAAGTTCTGGGCCTCAAGAGTTTGTTGTTGGCATACCCGGTCGTGCAGAGCAACAAGGTTCAGGAAGTGCTGAAGGCA
GCGCAGGAAGTCGGCGTGGAGTTTTTGCTGACGGTGGACAGCGCTGAGGGTGTTGATGCTGCGCAAAAGGCGTCGGAGGCTAGTGGCTGCAACTTGAAGC
TGCTGATTCACGTTGACGTTGGATATCACCGCGTGGGCATTGAGGAGGAGGACCCGCGACTGCTACAGCTTGCGCAGCGCATCGACAAGACGAGCACCCT
CGAGTTCTGCGGACTGCTGTCACACGCAGGTACGACGATCTTGCTACGGAGTGTTGGAGGAGGAGTGCGCTGACTGGTTTATTGTGCTTAGGCCATGCTT
ATCGCTGCAAGTCGGTAACGGAATGCTCGGAGGTTGCGGAGACAGAGAGGTCGATTATGGTTCGCATCAAGAGCATGCTGGAGCAGGTACGAACTCGGCG
GTATTGGGTGTTATTAGAGGTCTAACCGAGCTCTACTCGATGTTATATTAGAATGGAATCGCAGTCCCCGTCGTGTCGGTCGGAAGCACCTTGACGGAAT
TTGCTCGAAAGGACTTCACGGGCATCACGGAAGTTCGTCCGGGAAACTATGTGTTTCTTGATCGCACTCCTGTGCGCATGGGACTCTTCACCATGCAAGA
CGTCGCACTGACTGTTCTCGCCACGGTTGTGAGCTCAAACAAGTACAACTTCATCGTCGATGCAGGATCCAAGGTGTTGAGCTCGGATGGAGCTCGATCG
GCTGGTGATTTCGGCTCGACATGCTACGGCCTTGCCTTCTACGAAAAAGATTTCAACCGCGTTGTGAACGAGCCCACTCAGAACAAAACGCAGCTCGAGG
ATGGCAAGGAGCTGATCTGCTTCGAAGTGACCAGCCTGTCGGAAGAACACGGTTGGGTGAAGAAGATCGAGTGTATTCCTTCACCAGCCATCGGCCAACG
CCTTGTTATTGTGCCCAACCACGCCTGCGTGGTGTCGAATCTTACTGACAAGTTCTTCGTTCAGGGCGAACAGGCGAAGACCTGGAAGCTGCTGTCGCGT
GGCTGCACTCAGTGAAGTGCTCATTTTGCTATCGCCCACCAATGGCTCAGACATGACTTTAGCTTCATTTTAAAACCACTGCAGCTGAATGCTTTCGATA
AACTCGCGGCTGGCTTTGTCTTGGATCCGTCGCATCAACTCCTCTCTTGTTTTTGGCAGGGTGCTGGTGGCGCCACCGTCCTTGGCTCGGAAATTATCAA
GCATCTTGTTCGTGGCCACCTCAATCGCTTGCAGCTCTTGCTCTTGTGTAGCCATGTAGTGTTCGAACGCTTCAGTCTGCAGATGCGATTCACGCAGCGA
CTGCGCCCACTCCTCCTCGTACGCCAGCTTCACGAGATGCCTACGGAACGGAGATCGCAGGATCTTGGCGAGCATAGCTCTGAACGACACGTTCTCCACA
TCTAAAGCTTGCTCCGCAACATGCTCGAGGTTCCGATAAAAGGAGGAACTCTCAGTTTTGGCGGTAGGCGACGGTGAATGGTACATCCATGTCGTGAGAG
CATACCTCGGCTTGACCGACGGCATCACGCGGTGCAGCATTTGCTGCGACGAAAAGAGCACCATCTCGCCGAATCGCGGTTGCACCACGATACGCGTTTT
CGGGAACGGGTAAAGCACGATTTCACCTCCATCTCCGTGACCCCACTCCTCATTCAAGTAAAGCACCGCTGTAACGCACTTGCCGTCGTCTCCATAGGTA
TCAAAGTGCATCGGGAAGCAGGCTCCTCGTCCAGCATTGTGCTGCACCTTGACCATGTGTCCTGCAAGCCCCACCCATGCCGGCATCGCTTGAAGCAGTG
GACCAAACACCACTTGCTGCTCGAAAAAGTCTCTCAGGAACGGCACAGACGTTTGATCTCGAACCGCATCCAGCGCTAACTCCGTCTCCAGTATATCGTG
CTTCTCCAACAGCAGAGTCTTGGTCTTTGGTCCGTCGTTTAGCAAAATGTGCGTTGAGTTCGGGTACAATTGACCGCTGGTTCGAAGCAGCTTCATTTCG
TCGCGAAGGTGGTGGAGATACCCCTCCGGGAAGGCGTTGCGCACCACGTAGTAGCCATCGGTGAGCAG